Incidental Mutation 'R6788:Uggt1'
ID532461
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene NameUDP-glucose glycoprotein glucosyltransferase 1
SynonymsUgcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36140027-36244720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36230688 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 83 (T83S)
Ref Sequence ENSEMBL: ENSMUSP00000134640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]
Predicted Effect probably benign
Transcript: ENSMUST00000046875
AA Change: T83S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: T83S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174266
AA Change: T83S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470
AA Change: T83S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36162353 missense probably benign 0.37
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1592:Uggt1 UTSW 1 36202858 missense probably benign 0.04
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36202855 nonsense probably null
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R5893:Uggt1 UTSW 1 36227628 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36162221 missense probably damaging 0.99
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACCATGGCAACTGTCG -3'
(R):5'- CATTTGTACATTAGGGCTTCCC -3'

Sequencing Primer
(F):5'- CATGGCAACTGTCGTCATTAACG -3'
(R):5'- GCTACTGAGTGAACACATTATTATGC -3'
Posted On2018-08-29