Incidental Mutation 'R6788:Mepe'
ID532481
Institutional Source Beutler Lab
Gene Symbol Mepe
Ensembl Gene ENSMUSG00000053863
Gene Namematrix extracellular phosphoglycoprotein with ASARM motif (bone)
SynonymsOF45
MMRRC Submission
Accession Numbers

Genbank: NM_053172; MGI: 2137384

Is this an essential gene? Probably non essential (E-score: 0.015) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104325329-104338611 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104338208 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 405 (R405*)
Ref Sequence ENSEMBL: ENSMUSP00000065200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066207]
Predicted Effect probably null
Transcript: ENSMUST00000066207
AA Change: R405*
SMART Domains Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: R405*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Osteoregulin 29 192 4.2e-76 PFAM
low complexity region 257 272 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
Meta Mutation Damage Score 0.6236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Mepe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Mepe APN 5 104337977 missense probably damaging 1.00
IGL01896:Mepe APN 5 104338269 missense possibly damaging 0.85
IGL01997:Mepe APN 5 104337600 missense probably damaging 1.00
IGL02311:Mepe APN 5 104337705 missense probably damaging 0.98
IGL02586:Mepe APN 5 104337450 missense probably benign 0.39
F6893:Mepe UTSW 5 104337376 missense possibly damaging 0.87
R1187:Mepe UTSW 5 104338248 missense probably damaging 0.98
R1218:Mepe UTSW 5 104327073 missense probably benign
R1633:Mepe UTSW 5 104337674 missense probably benign 0.25
R2024:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2026:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2027:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2393:Mepe UTSW 5 104337461 missense possibly damaging 0.95
R2920:Mepe UTSW 5 104338247 missense probably damaging 0.99
R3040:Mepe UTSW 5 104338122 missense probably damaging 0.99
R3716:Mepe UTSW 5 104337428 missense probably benign 0.25
R3973:Mepe UTSW 5 104337078 missense probably benign
R3976:Mepe UTSW 5 104337078 missense probably benign
R4894:Mepe UTSW 5 104325402 missense probably damaging 0.98
R5556:Mepe UTSW 5 104338212 missense probably damaging 1.00
R6256:Mepe UTSW 5 104337074 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGCAAAGGTAGCTCTAGC -3'
(R):5'- TAGCACAATGTCCTGGAGGG -3'

Sequencing Primer
(F):5'- CAAAGGTAGCTCTAGCAAAGATG -3'
(R):5'- ACCAGGTCTGTTGGCTTGCTC -3'
Posted On2018-08-29