Incidental Mutation 'R6788:Cep57l1'
ID532507
Institutional Source Beutler Lab
Gene Symbol Cep57l1
Ensembl Gene ENSMUSG00000019813
Gene Namecentrosomal protein 57-like 1
Synonyms4930484D11Rik, 2410017P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location41718840-41809871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41743149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 74 (D74G)
Ref Sequence ENSEMBL: ENSMUSP00000141089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019951] [ENSMUST00000105505] [ENSMUST00000186239] [ENSMUST00000187143] [ENSMUST00000189770] [ENSMUST00000190022] [ENSMUST00000191498]
Predicted Effect probably damaging
Transcript: ENSMUST00000019951
AA Change: D74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019951
Gene: ENSMUSG00000019813
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 1.2e-64 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 283 356 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105505
AA Change: D74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101144
Gene: ENSMUSG00000019813
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186239
AA Change: D74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139509
Gene: ENSMUSG00000019813
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 2.3e-72 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 281 356 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187143
AA Change: D74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140389
Gene: ENSMUSG00000019813
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189770
AA Change: D74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140147
Gene: ENSMUSG00000019813
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190022
SMART Domains Protein: ENSMUSP00000141031
Gene: ENSMUSG00000019813

DomainStartEndE-ValueType
Pfam:Cep57_CLD 45 151 6.6e-38 PFAM
low complexity region 158 169 N/A INTRINSIC
Pfam:Cep57_MT_bd 205 280 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191498
AA Change: D74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141089
Gene: ENSMUSG00000019813
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 229 1.9e-65 PFAM
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Cep57l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep57l1 APN 10 41721551 intron probably benign
IGL00679:Cep57l1 APN 10 41719800 nonsense probably null
IGL00839:Cep57l1 APN 10 41731093 missense probably damaging 1.00
IGL01013:Cep57l1 APN 10 41740869 nonsense probably null
IGL01479:Cep57l1 APN 10 41728639 missense possibly damaging 0.95
IGL01830:Cep57l1 APN 10 41728653 missense probably benign 0.03
IGL02005:Cep57l1 APN 10 41740961 missense probably benign 0.39
IGL02679:Cep57l1 APN 10 41729386 missense probably damaging 1.00
IGL02697:Cep57l1 APN 10 41722954 missense possibly damaging 0.83
IGL03328:Cep57l1 APN 10 41743152 missense probably damaging 1.00
R2147:Cep57l1 UTSW 10 41740899 missense probably damaging 0.97
R3712:Cep57l1 UTSW 10 41743114 missense probably damaging 1.00
R4049:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4050:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4661:Cep57l1 UTSW 10 41719771 missense possibly damaging 0.91
R4764:Cep57l1 UTSW 10 41721682 missense possibly damaging 0.81
R4929:Cep57l1 UTSW 10 41745914 missense possibly damaging 0.93
R6058:Cep57l1 UTSW 10 41740922 missense possibly damaging 0.87
R6386:Cep57l1 UTSW 10 41743132 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTTCTATGACAGAAGAGCAG -3'
(R):5'- GGTTACTGGTAAGCAAACGTG -3'

Sequencing Primer
(F):5'- TTTCTATGACAGAAGAGCAGAGGCAG -3'
(R):5'- AAACGTGCCCTGCTCCTG -3'
Posted On2018-08-29