Incidental Mutation 'R6788:Ahsg'
ID532522
Institutional Source Beutler Lab
Gene Symbol Ahsg
Ensembl Gene ENSMUSG00000022868
Gene Namealpha-2-HS-glycoprotein
Synonymsfetuin-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location22891277-22899449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22894835 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000023583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023583] [ENSMUST00000231328] [ENSMUST00000231848] [ENSMUST00000231932] [ENSMUST00000232098] [ENSMUST00000232674]
Predicted Effect probably benign
Transcript: ENSMUST00000023583
AA Change: D122G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023583
Gene: ENSMUSG00000022868
AA Change: D122G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 22 133 8.6e-24 SMART
CY 145 248 6.58e-20 SMART
low complexity region 273 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231328
AA Change: D78G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231848
AA Change: D71G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232098
AA Change: D43G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232674
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha2-HS glycoprotein (AHSG), a glycoprotein present in the serum, is synthesized by hepatocytes. The AHSG molecule consists of two polypeptide chains, which are both cleaved from a proprotein encoded from a single mRNA. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. The protein is commonly present in the cortical plate of the immature cerebral cortex and bone marrow hemopoietic matrix, and it has therefore been postulated that it participates in the development of the tissues. However, its exact significance is still obscure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking this gene exhibit defective inhibition of serum apatite formation, sometimes causing muscle calcification. They are resistant to weight gain on a high-fat diet and have increased insulin sensitivity and glucose clearance and reduced fasting plasma free fatty acids and triglycerides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Ahsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01830:Ahsg APN 16 22899029 missense probably damaging 1.00
IGL01885:Ahsg APN 16 22898981 missense probably damaging 1.00
IGL02208:Ahsg APN 16 22892310 missense possibly damaging 0.89
IGL02593:Ahsg APN 16 22892328 critical splice donor site probably null
IGL03059:Ahsg APN 16 22899005 missense possibly damaging 0.57
R0257:Ahsg UTSW 16 22899040 missense probably benign
R0615:Ahsg UTSW 16 22899055 missense possibly damaging 0.92
R1829:Ahsg UTSW 16 22892328 unclassified probably benign
R5034:Ahsg UTSW 16 22898900 missense probably damaging 1.00
R5149:Ahsg UTSW 16 22898923 missense probably benign 0.02
R5670:Ahsg UTSW 16 22898163 missense probably benign
R6264:Ahsg UTSW 16 22898861 missense probably benign 0.00
R7026:Ahsg UTSW 16 22892213 missense probably damaging 1.00
R7027:Ahsg UTSW 16 22892257 missense probably damaging 0.99
X0060:Ahsg UTSW 16 22895262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCAATAACACCCGTGAAG -3'
(R):5'- TGAAGGTCACCAAGTCACAGC -3'

Sequencing Primer
(F):5'- TAACACCCGTGAAGGTTGC -3'
(R):5'- GGGACAATGTTCGCCCACAAG -3'
Posted On2018-08-29