Incidental Mutation 'R6788:Olfr93'
ID532526
Institutional Source Beutler Lab
Gene Symbol Olfr93
Ensembl Gene ENSMUSG00000091601
Gene Nameolfactory receptor 93
SynonymsGA_x6K02T2PSCP-1592036-1591098, MOR256-39P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37140423-37161494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37151822 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 50 (D50V)
Ref Sequence ENSEMBL: ENSMUSP00000151672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171679] [ENSMUST00000208003] [ENSMUST00000219235]
Predicted Effect probably damaging
Transcript: ENSMUST00000171679
AA Change: D50V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125907
Gene: ENSMUSG00000091601
AA Change: D50V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 3.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208003
Predicted Effect probably damaging
Transcript: ENSMUST00000219235
AA Change: D50V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Olfr93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Olfr93 APN 17 37151441 missense probably damaging 1.00
IGL02369:Olfr93 APN 17 37151774 missense probably damaging 1.00
IGL02392:Olfr93 APN 17 37151088 missense probably benign 0.03
IGL02516:Olfr93 APN 17 37151272 missense possibly damaging 0.95
IGL03089:Olfr93 APN 17 37151643 missense probably damaging 1.00
PIT4515001:Olfr93 UTSW 17 37151379 missense probably benign
R0396:Olfr93 UTSW 17 37151555 missense probably damaging 1.00
R2276:Olfr93 UTSW 17 37151254 nonsense probably null
R2278:Olfr93 UTSW 17 37151254 nonsense probably null
R3419:Olfr93 UTSW 17 37151351 missense probably damaging 0.99
R4254:Olfr93 UTSW 17 37151639 missense possibly damaging 0.90
R4353:Olfr93 UTSW 17 37151337 missense probably damaging 1.00
R4530:Olfr93 UTSW 17 37151607 missense possibly damaging 0.84
R4666:Olfr93 UTSW 17 37151379 missense possibly damaging 0.61
R5583:Olfr93 UTSW 17 37151594 missense probably benign 0.00
R5834:Olfr93 UTSW 17 37151799 missense probably damaging 1.00
R6348:Olfr93 UTSW 17 37151606 missense probably damaging 0.96
R6461:Olfr93 UTSW 17 37151471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGGTCAAAGGCCATTAC -3'
(R):5'- AAGCTGACAGTCTCATTCCTCC -3'

Sequencing Primer
(F):5'- TGTCAACAGGATGCACTCTG -3'
(R):5'- GTCTCATTCCTCCAACTAGATACAG -3'
Posted On2018-08-29