Incidental Mutation 'R6790:Cx3cr1'
ID 532556
Institutional Source Beutler Lab
Gene Symbol Cx3cr1
Ensembl Gene ENSMUSG00000052336
Gene Name C-X3-C motif chemokine receptor 1
Synonyms
MMRRC Submission 044903-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6790 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119877749-119897362 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119880833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 190 (V190M)
Ref Sequence ENSEMBL: ENSMUSP00000150463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064165] [ENSMUST00000177637] [ENSMUST00000215016]
AlphaFold Q9Z0D9
Predicted Effect probably damaging
Transcript: ENSMUST00000064165
AA Change: V190M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063986
Gene: ENSMUSG00000052336
AA Change: V190M

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 8.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177637
AA Change: V190M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336
AA Change: V190M

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215016
AA Change: V190M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Age related retinal degeneration with abnormal subretinal microglial cell accumulation in one homozygous null mice. Other null mice shows impaired monocyte recruitment after vascular injury, kidney ischemia and reperfusion, and bacterial infection of the instestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,987,448 (GRCm39) S457T probably damaging Het
Adgrf3 A G 5: 30,401,385 (GRCm39) V881A probably benign Het
Ankrd65 T G 4: 155,877,260 (GRCm39) probably null Het
Ascc3 A G 10: 50,521,808 (GRCm39) E441G probably damaging Het
Atf5 A T 7: 44,462,679 (GRCm39) probably null Het
Cfap97 G T 8: 46,623,113 (GRCm39) V168L possibly damaging Het
Crh T G 3: 19,748,459 (GRCm39) E61A probably damaging Het
Cyp3a59 A C 5: 146,033,143 (GRCm39) M172L probably benign Het
Dnm1 T C 2: 32,223,079 (GRCm39) K445R probably damaging Het
Eng C A 2: 32,559,457 (GRCm39) T82N probably damaging Het
Fkbp15 T C 4: 62,222,996 (GRCm39) T968A probably benign Het
Fsip2 A G 2: 82,821,283 (GRCm39) N5672S possibly damaging Het
Gm21149 A C 5: 15,677,103 (GRCm39) D250E unknown Het
Gon4l A G 3: 88,766,305 (GRCm39) E448G probably damaging Het
Hrnr T C 3: 93,236,382 (GRCm39) S2207P unknown Het
Itga4 C A 2: 79,155,958 (GRCm39) H975N probably benign Het
Kdm4c A G 4: 74,309,698 (GRCm39) K954E probably damaging Het
Lrrc20 G T 10: 61,362,898 (GRCm39) V48F probably damaging Het
Mga A G 2: 119,754,235 (GRCm39) I915V probably damaging Het
Npc1l1 C T 11: 6,164,260 (GRCm39) probably null Het
Nup50l T C 6: 96,142,304 (GRCm39) T247A probably benign Het
Or3a1b T A 11: 74,012,427 (GRCm39) L104H probably damaging Het
Pate13 G T 9: 35,820,127 (GRCm39) probably benign Het
Per2 C T 1: 91,373,261 (GRCm39) V176I probably benign Het
Pira2 A C 7: 3,845,442 (GRCm39) V314G probably damaging Het
Potefam3e A T 8: 19,779,801 (GRCm39) I14F probably benign Het
Rims1 T C 1: 22,507,278 (GRCm39) D624G probably damaging Het
Secisbp2 A G 13: 51,824,939 (GRCm39) T396A probably benign Het
Slc28a3 T C 13: 58,730,464 (GRCm39) D84G probably benign Het
Slc8a3 T C 12: 81,361,206 (GRCm39) T538A probably benign Het
Slk T A 19: 47,624,007 (GRCm39) C991S probably damaging Het
Stmn1 T C 4: 134,198,125 (GRCm39) L54S probably damaging Het
Tuft1 C G 3: 94,535,537 (GRCm39) E128D possibly damaging Het
Ugt8a T C 3: 125,665,340 (GRCm39) T386A possibly damaging Het
Zdhhc20 A G 14: 58,127,600 (GRCm39) V13A probably benign Het
Other mutations in Cx3cr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Cx3cr1 APN 9 119,880,503 (GRCm39) nonsense probably null
R0507:Cx3cr1 UTSW 9 119,881,022 (GRCm39) missense probably damaging 1.00
R1777:Cx3cr1 UTSW 9 119,880,659 (GRCm39) missense probably damaging 1.00
R2099:Cx3cr1 UTSW 9 119,881,339 (GRCm39) missense probably benign 0.00
R2120:Cx3cr1 UTSW 9 119,880,749 (GRCm39) missense probably damaging 1.00
R3746:Cx3cr1 UTSW 9 119,881,132 (GRCm39) missense probably damaging 1.00
R3747:Cx3cr1 UTSW 9 119,881,132 (GRCm39) missense probably damaging 1.00
R3748:Cx3cr1 UTSW 9 119,881,132 (GRCm39) missense probably damaging 1.00
R3939:Cx3cr1 UTSW 9 119,880,710 (GRCm39) missense probably benign
R4629:Cx3cr1 UTSW 9 119,880,730 (GRCm39) missense probably damaging 1.00
R6185:Cx3cr1 UTSW 9 119,880,444 (GRCm39) missense probably benign 0.06
R6244:Cx3cr1 UTSW 9 119,880,760 (GRCm39) missense probably damaging 1.00
R7448:Cx3cr1 UTSW 9 119,881,282 (GRCm39) missense probably benign 0.00
R8081:Cx3cr1 UTSW 9 119,880,878 (GRCm39) missense possibly damaging 0.81
R8138:Cx3cr1 UTSW 9 119,880,649 (GRCm39) missense possibly damaging 0.74
R9455:Cx3cr1 UTSW 9 119,880,659 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCAGGAAAATCATGATGTTG -3'
(R):5'- TCATCAGCATCGACCGGTAC -3'

Sequencing Primer
(F):5'- CCAGGAAAATCATGATGTTGTATGG -3'
(R):5'- AGCATCGACCGGTACCTTGC -3'
Posted On 2018-08-29