Incidental Mutation 'R6791:Skor1'
ID532594
Institutional Source Beutler Lab
Gene Symbol Skor1
Ensembl Gene ENSMUSG00000022245
Gene NameSKI family transcriptional corepressor 1
SynonymsCorl1, C230094B15Rik, Lbxcor1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R6791 (G1)
Quality Score179.009
Status Validated
Chromosome9
Chromosomal Location63138170-63148961 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 63140354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055281] [ENSMUST00000116613] [ENSMUST00000119146]
Predicted Effect probably null
Transcript: ENSMUST00000055281
SMART Domains Protein: ENSMUSP00000055037
Gene: ENSMUSG00000022245

DomainStartEndE-ValueType
Pfam:Ski_Sno 61 168 3.2e-41 PFAM
c-SKI_SMAD_bind 180 272 2.48e-56 SMART
low complexity region 284 312 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
low complexity region 345 366 N/A INTRINSIC
low complexity region 379 398 N/A INTRINSIC
low complexity region 414 454 N/A INTRINSIC
low complexity region 465 479 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 568 582 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
SCOP:d1eq1a_ 850 937 1e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116613
SMART Domains Protein: ENSMUSP00000112312
Gene: ENSMUSG00000022245

DomainStartEndE-ValueType
Pfam:Ski_Sno 17 130 3.5e-42 PFAM
c-SKI_SMAD_bind 141 233 2.48e-56 SMART
low complexity region 245 273 N/A INTRINSIC
low complexity region 294 303 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
low complexity region 375 415 N/A INTRINSIC
low complexity region 426 440 N/A INTRINSIC
low complexity region 463 486 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
SCOP:d1eq1a_ 811 898 1e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119146
SMART Domains Protein: ENSMUSP00000113924
Gene: ENSMUSG00000022245

DomainStartEndE-ValueType
Pfam:Ski_Sno 28 141 3e-42 PFAM
c-SKI_SMAD_bind 152 244 2.48e-56 SMART
low complexity region 256 284 N/A INTRINSIC
low complexity region 305 314 N/A INTRINSIC
low complexity region 317 338 N/A INTRINSIC
low complexity region 351 370 N/A INTRINSIC
low complexity region 386 426 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
low complexity region 474 497 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
SCOP:d1eq1a_ 822 909 1e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Skor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Skor1 APN 9 63146441 missense probably damaging 1.00
IGL00736:Skor1 APN 9 63139538 missense probably damaging 0.99
IGL01344:Skor1 APN 9 63142278 missense possibly damaging 0.79
IGL01383:Skor1 APN 9 63146556 missense probably benign 0.12
IGL01456:Skor1 APN 9 63145490 missense probably damaging 1.00
IGL02503:Skor1 APN 9 63146115 missense probably damaging 1.00
IGL02526:Skor1 APN 9 63145877 missense probably damaging 1.00
IGL02699:Skor1 APN 9 63140046 splice site probably benign
R0041:Skor1 UTSW 9 63145851 missense probably damaging 1.00
R0092:Skor1 UTSW 9 63145995 missense probably damaging 1.00
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1581:Skor1 UTSW 9 63146223 missense probably damaging 1.00
R1598:Skor1 UTSW 9 63146004 missense probably damaging 1.00
R2172:Skor1 UTSW 9 63145122 missense possibly damaging 0.84
R3734:Skor1 UTSW 9 63140068 missense probably damaging 1.00
R3803:Skor1 UTSW 9 63145586 missense probably benign 0.06
R3839:Skor1 UTSW 9 63144448 missense probably damaging 0.97
R4627:Skor1 UTSW 9 63145476 missense probably damaging 1.00
R4698:Skor1 UTSW 9 63144548 missense probably benign
R4712:Skor1 UTSW 9 63139573 splice site probably null
R4781:Skor1 UTSW 9 63144459 missense probably benign
R5089:Skor1 UTSW 9 63145923 missense probably damaging 0.99
R5735:Skor1 UTSW 9 63146064 missense probably damaging 1.00
R6279:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6300:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6396:Skor1 UTSW 9 63144950 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCAAATTGATTAAGTGAGAGCTG -3'
(R):5'- ACTCAGGTGTCAGGACTGTTG -3'

Sequencing Primer
(F):5'- TGTTAAGCACAGCCTCCTC -3'
(R):5'- ACTGTTGGCCAGGACAGAC -3'
Posted On2018-08-29