Incidental Mutation 'R6792:Exph5'
ID532653
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Nameexophilin 5
SynonymsSlac2b, AC079869.22gm5, B130009M24Rik, slac2-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53301670-53377514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53375317 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1233 (V1233M)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051014
AA Change: V1233M

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: V1233M

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53376706 nonsense probably null
IGL01387:Exph5 APN 9 53373965 missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53376569 missense probably damaging 0.99
IGL02122:Exph5 APN 9 53373674 missense probably benign 0.05
IGL02156:Exph5 APN 9 53375641 missense probably damaging 0.96
IGL02192:Exph5 APN 9 53376325 nonsense probably null
IGL02491:Exph5 APN 9 53375043 missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53374978 missense probably damaging 0.96
R0002:Exph5 UTSW 9 53373956 missense probably damaging 0.99
R0026:Exph5 UTSW 9 53376479 missense probably benign 0.38
R0086:Exph5 UTSW 9 53337930 missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53353204 critical splice donor site probably null
R0369:Exph5 UTSW 9 53373302 missense probably benign 0.35
R0409:Exph5 UTSW 9 53374343 missense probably benign 0.00
R0517:Exph5 UTSW 9 53372762 missense probably benign 0.02
R0658:Exph5 UTSW 9 53377475 missense unknown
R1606:Exph5 UTSW 9 53374295 missense probably benign 0.37
R1739:Exph5 UTSW 9 53375588 missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53373809 missense probably benign 0.35
R1828:Exph5 UTSW 9 53376641 missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53376248 missense probably benign
R1993:Exph5 UTSW 9 53373635 missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53367166 missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53372679 missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53374925 nonsense probably null
R3817:Exph5 UTSW 9 53375494 nonsense probably null
R4771:Exph5 UTSW 9 53373665 missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53376239 missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53376625 missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53375610 missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53337930 missense probably damaging 0.99
R5522:Exph5 UTSW 9 53374313 missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53375222 missense probably benign 0.04
R5961:Exph5 UTSW 9 53377255 missense probably damaging 1.00
R6093:Exph5 UTSW 9 53372617 missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53373028 missense probably benign 0.21
R6254:Exph5 UTSW 9 53372710 missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53376691 missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53301712 start gained probably benign
R7026:Exph5 UTSW 9 53340428 missense probably benign 0.27
R7340:Exph5 UTSW 9 53377009 missense probably damaging 0.99
R7347:Exph5 UTSW 9 53375896 missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53375722 missense probably benign 0.00
X0028:Exph5 UTSW 9 53376263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAACCATCGTTTAGAGAG -3'
(R):5'- TGCAGGACAGTTCAGCTCATC -3'

Sequencing Primer
(F):5'- ACCATCGTTTAGAGAGAGTGCTTTC -3'
(R):5'- AGGACAGTTCAGCTCATCGATTTC -3'
Posted On2018-08-29