Incidental Mutation 'R6793:Ptprn'
ID532676
Institutional Source Beutler Lab
Gene Symbol Ptprn
Ensembl Gene ENSMUSG00000026204
Gene Nameprotein tyrosine phosphatase, receptor type, N
SynonymsIA-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R6793 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75247027-75264502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75258142 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 267 (T267I)
Ref Sequence ENSEMBL: ENSMUSP00000027404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404] [ENSMUST00000185849] [ENSMUST00000186178] [ENSMUST00000189769]
Predicted Effect probably benign
Transcript: ENSMUST00000027404
AA Change: T267I

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204
AA Change: T267I

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185849
SMART Domains Protein: ENSMUSP00000140062
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 1 62 5e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186178
SMART Domains Protein: ENSMUSP00000139925
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 27 128 1.5e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189769
SMART Domains Protein: ENSMUSP00000140168
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 56 157 1.5e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A C 14: 32,806,821 I48L probably benign Het
2010315B03Rik A T 9: 124,295,422 N19K possibly damaging Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Abraxas2 T C 7: 132,874,834 I98T probably damaging Het
Ankrd17 G A 5: 90,265,512 T1181I probably damaging Het
Bsn T A 9: 108,114,615 K1313* probably null Het
C130060K24Rik C T 6: 65,381,421 A43V probably benign Het
Chst4 A T 8: 110,030,067 V388D probably damaging Het
Ckap5 T G 2: 91,568,709 W613G probably damaging Het
Clock GACTCACT GACT 5: 76,237,120 probably null Het
Enpp1 T C 10: 24,655,825 D520G probably damaging Het
Epha3 T C 16: 63,773,455 N90S probably benign Het
Esp36 A T 17: 38,417,114 M92K unknown Het
Fam135a A G 1: 24,067,925 V44A possibly damaging Het
Fndc8 T C 11: 82,897,586 S81P probably damaging Het
Fsip2 T G 2: 82,989,494 N5190K probably benign Het
Gabrr1 T G 4: 33,162,712 V426G possibly damaging Het
Igkv6-15 T A 6: 70,406,992 M1L probably benign Het
Lrrc36 A G 8: 105,458,433 E614G probably damaging Het
Man1a2 A T 3: 100,632,597 I176K possibly damaging Het
Mapk4 T A 18: 73,930,468 N561I probably damaging Het
Med15 A T 16: 17,652,703 probably benign Het
Mfsd2a A G 4: 122,950,705 V258A probably benign Het
Micu3 G A 8: 40,380,695 V457I probably damaging Het
Mov10l1 T A 15: 88,996,184 V291E possibly damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ncbp1 T C 4: 46,157,827 I355T probably damaging Het
Olfr571 A G 7: 102,909,728 V37A probably benign Het
Olfr600 T C 7: 103,346,266 T221A probably benign Het
Otub2 A G 12: 103,389,019 probably benign Het
Pcdh15 T C 10: 74,631,139 S1666P probably damaging Het
Pcdha12 T A 18: 37,022,181 V651E probably damaging Het
Pomt1 T C 2: 32,242,949 F186L probably damaging Het
Prl3d3 G A 13: 27,161,061 A140T probably benign Het
Rhbdd2 T A 5: 135,636,154 I113N probably damaging Het
Saraf T A 8: 34,168,613 probably null Het
Slc41a2 T C 10: 83,301,158 probably null Het
Slc47a1 A G 11: 61,359,403 V352A probably benign Het
Tmem237 T C 1: 59,114,216 T49A probably benign Het
Tmprss11e C T 5: 86,715,555 C217Y probably damaging Het
Ubfd1 T C 7: 122,067,880 V140A probably benign Het
Utrn A G 10: 12,640,925 probably null Het
Utrn T A 10: 12,699,100 I1028F possibly damaging Het
Virma C T 4: 11,539,968 T1479M probably damaging Het
Vwa7 G T 17: 35,024,891 R767L probably benign Het
Wdfy3 A T 5: 101,917,431 Y1290* probably null Het
Zfp970 G A 2: 177,475,545 C304Y probably damaging Het
Other mutations in Ptprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Ptprn APN 1 75252270 missense probably damaging 0.99
IGL01900:Ptprn APN 1 75252248 splice site probably benign
IGL02189:Ptprn APN 1 75258495 missense possibly damaging 0.73
IGL02282:Ptprn APN 1 75253156 missense probably damaging 1.00
IGL02452:Ptprn APN 1 75258169 missense probably benign 0.34
IGL02865:Ptprn APN 1 75262363 missense probably damaging 1.00
IGL02926:Ptprn APN 1 75247873 missense possibly damaging 0.95
IGL03062:Ptprn APN 1 75247873 missense possibly damaging 0.95
H8562:Ptprn UTSW 1 75254620 missense possibly damaging 0.66
R0051:Ptprn UTSW 1 75252254 critical splice donor site probably null
R0107:Ptprn UTSW 1 75255712 missense probably damaging 0.99
R0801:Ptprn UTSW 1 75252265 missense probably damaging 1.00
R0865:Ptprn UTSW 1 75248138 unclassified probably null
R1120:Ptprn UTSW 1 75258181 missense probably benign 0.00
R1534:Ptprn UTSW 1 75257943 critical splice donor site probably null
R1740:Ptprn UTSW 1 75262050 missense probably damaging 1.00
R1857:Ptprn UTSW 1 75247905 missense possibly damaging 0.64
R1927:Ptprn UTSW 1 75254122 missense probably benign 0.00
R1974:Ptprn UTSW 1 75254820 unclassified probably null
R2071:Ptprn UTSW 1 75255144 missense probably damaging 1.00
R2223:Ptprn UTSW 1 75257937 unclassified probably benign
R3714:Ptprn UTSW 1 75252767 splice site probably null
R4617:Ptprn UTSW 1 75252287 missense possibly damaging 0.74
R4832:Ptprn UTSW 1 75258265 missense probably benign 0.37
R5503:Ptprn UTSW 1 75251875 missense probably damaging 1.00
R5926:Ptprn UTSW 1 75254598 missense probably damaging 1.00
R6217:Ptprn UTSW 1 75248166 missense probably damaging 1.00
R6419:Ptprn UTSW 1 75264037 missense probably benign 0.10
R6964:Ptprn UTSW 1 75260649 missense possibly damaging 0.83
R7071:Ptprn UTSW 1 75260619 missense possibly damaging 0.82
X0017:Ptprn UTSW 1 75253265 missense probably benign 0.15
Z1088:Ptprn UTSW 1 75260620 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACTGCTACCTGGTTGTGCTG -3'
(R):5'- CTGCACTGCTACAGCCTTAC -3'

Sequencing Primer
(F):5'- CTTGGGGAGGGGACTTCTC -3'
(R):5'- TCTTCCACCAGGTGAGACC -3'
Posted On2018-08-29