Incidental Mutation 'R6793:A2ml1'
ID532693
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6793 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 128546329 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1215 (Q1215*)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably null
Transcript: ENSMUST00000060574
AA Change: Q1215*
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: Q1215*

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A C 14: 32,806,821 I48L probably benign Het
2010315B03Rik A T 9: 124,295,422 N19K possibly damaging Het
Abraxas2 T C 7: 132,874,834 I98T probably damaging Het
Ankrd17 G A 5: 90,265,512 T1181I probably damaging Het
Bsn T A 9: 108,114,615 K1313* probably null Het
C130060K24Rik C T 6: 65,381,421 A43V probably benign Het
Chst4 A T 8: 110,030,067 V388D probably damaging Het
Ckap5 T G 2: 91,568,709 W613G probably damaging Het
Clock GACTCACT GACT 5: 76,237,120 probably null Het
Enpp1 T C 10: 24,655,825 D520G probably damaging Het
Epha3 T C 16: 63,773,455 N90S probably benign Het
Esp36 A T 17: 38,417,114 M92K unknown Het
Fam135a A G 1: 24,067,925 V44A possibly damaging Het
Fndc8 T C 11: 82,897,586 S81P probably damaging Het
Fsip2 T G 2: 82,989,494 N5190K probably benign Het
Gabrr1 T G 4: 33,162,712 V426G possibly damaging Het
Igkv6-15 T A 6: 70,406,992 M1L probably benign Het
Lrrc36 A G 8: 105,458,433 E614G probably damaging Het
Man1a2 A T 3: 100,632,597 I176K possibly damaging Het
Mapk4 T A 18: 73,930,468 N561I probably damaging Het
Med15 A T 16: 17,652,703 probably benign Het
Mfsd2a A G 4: 122,950,705 V258A probably benign Het
Micu3 G A 8: 40,380,695 V457I probably damaging Het
Mov10l1 T A 15: 88,996,184 V291E possibly damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ncbp1 T C 4: 46,157,827 I355T probably damaging Het
Olfr571 A G 7: 102,909,728 V37A probably benign Het
Olfr600 T C 7: 103,346,266 T221A probably benign Het
Otub2 A G 12: 103,389,019 probably benign Het
Pcdh15 T C 10: 74,631,139 S1666P probably damaging Het
Pcdha12 T A 18: 37,022,181 V651E probably damaging Het
Pomt1 T C 2: 32,242,949 F186L probably damaging Het
Prl3d3 G A 13: 27,161,061 A140T probably benign Het
Ptprn G A 1: 75,258,142 T267I probably benign Het
Rhbdd2 T A 5: 135,636,154 I113N probably damaging Het
Saraf T A 8: 34,168,613 probably null Het
Slc41a2 T C 10: 83,301,158 probably null Het
Slc47a1 A G 11: 61,359,403 V352A probably benign Het
Tmem237 T C 1: 59,114,216 T49A probably benign Het
Tmprss11e C T 5: 86,715,555 C217Y probably damaging Het
Ubfd1 T C 7: 122,067,880 V140A probably benign Het
Utrn A G 10: 12,640,925 probably null Het
Utrn T A 10: 12,699,100 I1028F possibly damaging Het
Virma C T 4: 11,539,968 T1479M probably damaging Het
Vwa7 G T 17: 35,024,891 R767L probably benign Het
Wdfy3 A T 5: 101,917,431 Y1290* probably null Het
Zfp970 G A 2: 177,475,545 C304Y probably damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 unclassified probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGCTTTTCACCTCAGAAGC -3'
(R):5'- CCTCTGAGTGGGTAACTTATAGG -3'

Sequencing Primer
(F):5'- ACCTCAGAAGCTCTGTTATTGTGAC -3'
(R):5'- AGCTTGTTTTAAGGACTTGTGGAAAC -3'
Posted On2018-08-29