Incidental Mutation 'R6793:Lrrc36'
ID532700
Institutional Source Beutler Lab
Gene Symbol Lrrc36
Ensembl Gene ENSMUSG00000054320
Gene Nameleucine rich repeat containing 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R6793 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105413571-105464086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105458433 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 614 (E614G)
Ref Sequence ENSEMBL: ENSMUSP00000149382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067305] [ENSMUST00000109355] [ENSMUST00000213547] [ENSMUST00000216765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067305
AA Change: E493G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066345
Gene: ENSMUSG00000054320
AA Change: E493G

DomainStartEndE-ValueType
low complexity region 377 389 N/A INTRINSIC
coiled coil region 478 550 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109355
AA Change: E616G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104979
Gene: ENSMUSG00000054320
AA Change: E616G

DomainStartEndE-ValueType
Pfam:LRR_8 24 84 2.9e-8 PFAM
low complexity region 500 512 N/A INTRINSIC
coiled coil region 601 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213547
AA Change: E614G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216457
Predicted Effect probably damaging
Transcript: ENSMUST00000216765
AA Change: E614G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A C 14: 32,806,821 I48L probably benign Het
2010315B03Rik A T 9: 124,295,422 N19K possibly damaging Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Abraxas2 T C 7: 132,874,834 I98T probably damaging Het
Ankrd17 G A 5: 90,265,512 T1181I probably damaging Het
Bsn T A 9: 108,114,615 K1313* probably null Het
C130060K24Rik C T 6: 65,381,421 A43V probably benign Het
Chst4 A T 8: 110,030,067 V388D probably damaging Het
Ckap5 T G 2: 91,568,709 W613G probably damaging Het
Clock GACTCACT GACT 5: 76,237,120 probably null Het
Enpp1 T C 10: 24,655,825 D520G probably damaging Het
Epha3 T C 16: 63,773,455 N90S probably benign Het
Esp36 A T 17: 38,417,114 M92K unknown Het
Fam135a A G 1: 24,067,925 V44A possibly damaging Het
Fndc8 T C 11: 82,897,586 S81P probably damaging Het
Fsip2 T G 2: 82,989,494 N5190K probably benign Het
Gabrr1 T G 4: 33,162,712 V426G possibly damaging Het
Igkv6-15 T A 6: 70,406,992 M1L probably benign Het
Man1a2 A T 3: 100,632,597 I176K possibly damaging Het
Mapk4 T A 18: 73,930,468 N561I probably damaging Het
Med15 A T 16: 17,652,703 probably benign Het
Mfsd2a A G 4: 122,950,705 V258A probably benign Het
Micu3 G A 8: 40,380,695 V457I probably damaging Het
Mov10l1 T A 15: 88,996,184 V291E possibly damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ncbp1 T C 4: 46,157,827 I355T probably damaging Het
Olfr571 A G 7: 102,909,728 V37A probably benign Het
Olfr600 T C 7: 103,346,266 T221A probably benign Het
Otub2 A G 12: 103,389,019 probably benign Het
Pcdh15 T C 10: 74,631,139 S1666P probably damaging Het
Pcdha12 T A 18: 37,022,181 V651E probably damaging Het
Pomt1 T C 2: 32,242,949 F186L probably damaging Het
Prl3d3 G A 13: 27,161,061 A140T probably benign Het
Ptprn G A 1: 75,258,142 T267I probably benign Het
Rhbdd2 T A 5: 135,636,154 I113N probably damaging Het
Saraf T A 8: 34,168,613 probably null Het
Slc41a2 T C 10: 83,301,158 probably null Het
Slc47a1 A G 11: 61,359,403 V352A probably benign Het
Tmem237 T C 1: 59,114,216 T49A probably benign Het
Tmprss11e C T 5: 86,715,555 C217Y probably damaging Het
Ubfd1 T C 7: 122,067,880 V140A probably benign Het
Utrn A G 10: 12,640,925 probably null Het
Utrn T A 10: 12,699,100 I1028F possibly damaging Het
Virma C T 4: 11,539,968 T1479M probably damaging Het
Vwa7 G T 17: 35,024,891 R767L probably benign Het
Wdfy3 A T 5: 101,917,431 Y1290* probably null Het
Zfp970 G A 2: 177,475,545 C304Y probably damaging Het
Other mutations in Lrrc36
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1509:Lrrc36 UTSW 8 105461129 missense probably damaging 1.00
R1638:Lrrc36 UTSW 8 105449641 missense possibly damaging 0.92
R1800:Lrrc36 UTSW 8 105449765 missense probably damaging 1.00
R2296:Lrrc36 UTSW 8 105461019 missense possibly damaging 0.81
R4030:Lrrc36 UTSW 8 105426807 missense probably damaging 1.00
R4059:Lrrc36 UTSW 8 105427796 missense probably damaging 1.00
R4613:Lrrc36 UTSW 8 105449614 missense possibly damaging 0.95
R4755:Lrrc36 UTSW 8 105452144 missense possibly damaging 0.83
R4786:Lrrc36 UTSW 8 105455278 missense probably benign 0.01
R4828:Lrrc36 UTSW 8 105455230 missense probably benign 0.45
R4911:Lrrc36 UTSW 8 105426935 missense probably benign 0.26
R5135:Lrrc36 UTSW 8 105463898 missense probably benign
R5221:Lrrc36 UTSW 8 105443856 missense probably damaging 0.99
R5354:Lrrc36 UTSW 8 105425364 missense probably damaging 0.99
R5635:Lrrc36 UTSW 8 105457573 missense probably damaging 0.97
R6950:Lrrc36 UTSW 8 105425389 splice site probably null
R6986:Lrrc36 UTSW 8 105458447 missense probably damaging 0.99
R7231:Lrrc36 UTSW 8 105461057 missense possibly damaging 0.46
R7326:Lrrc36 UTSW 8 105449769 missense possibly damaging 0.92
R7349:Lrrc36 UTSW 8 105452268 missense probably damaging 1.00
U24488:Lrrc36 UTSW 8 105449752 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGAGTCTGGCTACCCTCATATG -3'
(R):5'- GATCCTAATTCCCATTGAGTCGC -3'

Sequencing Primer
(F):5'- GGCTACCCTCATATGAATCAAACTTG -3'
(R):5'- AGACCAAAGGCAGCCTGTG -3'
Posted On2018-08-29