Incidental Mutation 'R6793:Chst4'
ID532701
Institutional Source Beutler Lab
Gene Symbol Chst4
Ensembl Gene ENSMUSG00000035930
Gene Namecarbohydrate (chondroitin 6/keratan) sulfotransferase 4
SynonymsGST-3, HEC-GlcNAc6ST, high endothelial cell GlcNAC-6-sulphotransferase
MMRRC Submission
Accession Numbers

Genbank: NM_011998;  MGI: 1349479

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6793 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location110029153-110039740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110030067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 388 (V388D)
Ref Sequence ENSEMBL: ENSMUSP00000148741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109222] [ENSMUST00000211894] [ENSMUST00000212934]
Predicted Effect probably damaging
Transcript: ENSMUST00000109222
AA Change: V305D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104845
Gene: ENSMUSG00000035930
AA Change: V305D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Sulfotransfer_3 41 296 6.4e-15 PFAM
Pfam:Sulfotransfer_1 41 357 2.4e-26 PFAM
low complexity region 370 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211894
AA Change: V388D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212934
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene do not accumulate lymphocytes in peripheral lymph nodes to as great an extent as normal. The animals are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A C 14: 32,806,821 I48L probably benign Het
2010315B03Rik A T 9: 124,295,422 N19K possibly damaging Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Abraxas2 T C 7: 132,874,834 I98T probably damaging Het
Ankrd17 G A 5: 90,265,512 T1181I probably damaging Het
Bsn T A 9: 108,114,615 K1313* probably null Het
C130060K24Rik C T 6: 65,381,421 A43V probably benign Het
Ckap5 T G 2: 91,568,709 W613G probably damaging Het
Clock GACTCACT GACT 5: 76,237,120 probably null Het
Enpp1 T C 10: 24,655,825 D520G probably damaging Het
Epha3 T C 16: 63,773,455 N90S probably benign Het
Esp36 A T 17: 38,417,114 M92K unknown Het
Fam135a A G 1: 24,067,925 V44A possibly damaging Het
Fndc8 T C 11: 82,897,586 S81P probably damaging Het
Fsip2 T G 2: 82,989,494 N5190K probably benign Het
Gabrr1 T G 4: 33,162,712 V426G possibly damaging Het
Igkv6-15 T A 6: 70,406,992 M1L probably benign Het
Lrrc36 A G 8: 105,458,433 E614G probably damaging Het
Man1a2 A T 3: 100,632,597 I176K possibly damaging Het
Mapk4 T A 18: 73,930,468 N561I probably damaging Het
Med15 A T 16: 17,652,703 probably benign Het
Mfsd2a A G 4: 122,950,705 V258A probably benign Het
Micu3 G A 8: 40,380,695 V457I probably damaging Het
Mov10l1 T A 15: 88,996,184 V291E possibly damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ncbp1 T C 4: 46,157,827 I355T probably damaging Het
Olfr571 A G 7: 102,909,728 V37A probably benign Het
Olfr600 T C 7: 103,346,266 T221A probably benign Het
Otub2 A G 12: 103,389,019 probably benign Het
Pcdh15 T C 10: 74,631,139 S1666P probably damaging Het
Pcdha12 T A 18: 37,022,181 V651E probably damaging Het
Pomt1 T C 2: 32,242,949 F186L probably damaging Het
Prl3d3 G A 13: 27,161,061 A140T probably benign Het
Ptprn G A 1: 75,258,142 T267I probably benign Het
Rhbdd2 T A 5: 135,636,154 I113N probably damaging Het
Saraf T A 8: 34,168,613 probably null Het
Slc41a2 T C 10: 83,301,158 probably null Het
Slc47a1 A G 11: 61,359,403 V352A probably benign Het
Tmem237 T C 1: 59,114,216 T49A probably benign Het
Tmprss11e C T 5: 86,715,555 C217Y probably damaging Het
Ubfd1 T C 7: 122,067,880 V140A probably benign Het
Utrn A G 10: 12,640,925 probably null Het
Utrn T A 10: 12,699,100 I1028F possibly damaging Het
Virma C T 4: 11,539,968 T1479M probably damaging Het
Vwa7 G T 17: 35,024,891 R767L probably benign Het
Wdfy3 A T 5: 101,917,431 Y1290* probably null Het
Zfp970 G A 2: 177,475,545 C304Y probably damaging Het
Other mutations in Chst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Chst4 APN 8 110029965 missense probably benign 0.14
A4554:Chst4 UTSW 8 110029888 missense probably benign 0.09
R0091:Chst4 UTSW 8 110030665 missense probably damaging 1.00
R0373:Chst4 UTSW 8 110030394 missense probably damaging 1.00
R1171:Chst4 UTSW 8 110030623 missense probably damaging 1.00
R1577:Chst4 UTSW 8 110029844 missense probably benign 0.00
R2377:Chst4 UTSW 8 110030172 missense possibly damaging 0.80
R3421:Chst4 UTSW 8 110030406 missense probably damaging 1.00
R5514:Chst4 UTSW 8 110029974 missense probably damaging 1.00
R7141:Chst4 UTSW 8 110030839 missense probably damaging 1.00
R7146:Chst4 UTSW 8 110030731 missense probably damaging 1.00
R7183:Chst4 UTSW 8 110029998 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AAGATCCAGGGACAGGTTGC -3'
(R):5'- GCCCTATTATGCCATGAAGATCATC -3'

Sequencing Primer
(F):5'- CAGGGACAGGTTGCCTTGTTC -3'
(R):5'- TCATCTGCAAAAGCCAGGTGG -3'
Posted On2018-08-29