Incidental Mutation 'R6743:Pam'
ID532724
Institutional Source Beutler Lab
Gene Symbol Pam
Ensembl Gene ENSMUSG00000026335
Gene Namepeptidylglycine alpha-amidating monooxygenase
SynonymsPHM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97795114-98095646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97896049 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 219 (V219A)
Ref Sequence ENSEMBL: ENSMUSP00000125418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058762] [ENSMUST00000097625] [ENSMUST00000161567]
Predicted Effect probably benign
Transcript: ENSMUST00000058762
AA Change: V219A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000057112
Gene: ENSMUSG00000026335
AA Change: V219A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 62 178 7.8e-27 PFAM
Pfam:Cu2_monoox_C 199 346 6.2e-47 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.7e-8 PFAM
Pfam:NHL 782 809 2.8e-7 PFAM
transmembrane domain 870 892 N/A INTRINSIC
low complexity region 908 930 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097625
AA Change: V219A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000095228
Gene: ENSMUSG00000026335
AA Change: V219A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.7e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.4e-54 PFAM
Pfam:NHL 581 608 9.4e-9 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.2e-8 PFAM
Pfam:NHL 782 809 3.6e-8 PFAM
transmembrane domain 869 891 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159841
SMART Domains Protein: ENSMUSP00000124479
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
Pfam:Cu2_monoox_C 1 53 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161567
AA Change: V219A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125418
Gene: ENSMUSG00000026335
AA Change: V219A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.2e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.2e-54 PFAM
Pfam:NHL 475 502 8.3e-9 PFAM
Pfam:NHL 527 556 1.9e-8 PFAM
low complexity region 567 574 N/A INTRINSIC
Pfam:NHL 580 608 1.9e-8 PFAM
Pfam:NHL 676 703 3.2e-8 PFAM
transmembrane domain 764 786 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 844 863 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development, edema, abnormal yolk sac vasculature, thin arterial walls, and abnormal bronchial epithelial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Pam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pam APN 1 97924427 splice site probably benign
IGL00485:Pam APN 1 97822953 missense possibly damaging 0.78
IGL00597:Pam APN 1 97834444 missense probably benign 0.02
IGL01585:Pam APN 1 97864472 missense probably damaging 0.99
IGL01776:Pam APN 1 97885600 critical splice donor site probably null
IGL01981:Pam APN 1 97834441 missense probably damaging 1.00
IGL02152:Pam APN 1 97840749 missense probably damaging 1.00
IGL02605:Pam APN 1 97840339 missense possibly damaging 0.85
IGL02882:Pam APN 1 97840367 missense probably damaging 1.00
IGL03142:Pam APN 1 97894386 missense probably damaging 1.00
IGL03409:Pam APN 1 97864329 missense probably benign 0.04
R0084:Pam UTSW 1 97896049 missense probably benign 0.01
R0200:Pam UTSW 1 97894401 unclassified probably null
R0520:Pam UTSW 1 97884195 missense probably benign 0.00
R0734:Pam UTSW 1 97864362 nonsense probably null
R1881:Pam UTSW 1 97923151 missense probably benign 0.06
R2040:Pam UTSW 1 97864442 missense possibly damaging 0.55
R2106:Pam UTSW 1 97831490 missense probably damaging 1.00
R2913:Pam UTSW 1 97923129 missense probably damaging 1.00
R3148:Pam UTSW 1 97895678 missense possibly damaging 0.84
R3618:Pam UTSW 1 97834432 missense probably damaging 1.00
R3619:Pam UTSW 1 97834432 missense probably damaging 1.00
R3847:Pam UTSW 1 97854756 intron probably benign
R3848:Pam UTSW 1 97854756 intron probably benign
R3849:Pam UTSW 1 97854756 intron probably benign
R4128:Pam UTSW 1 97834468 missense probably damaging 0.99
R4231:Pam UTSW 1 97884124 critical splice donor site probably null
R4233:Pam UTSW 1 97864394 missense possibly damaging 0.86
R4404:Pam UTSW 1 97854721 intron probably benign
R4536:Pam UTSW 1 97844699 nonsense probably null
R4738:Pam UTSW 1 97923132 missense probably damaging 1.00
R5054:Pam UTSW 1 97821917 missense probably damaging 1.00
R5501:Pam UTSW 1 97840365 nonsense probably null
R5572:Pam UTSW 1 97854744 intron probably benign
R5654:Pam UTSW 1 97864398 missense probably benign 0.00
R5659:Pam UTSW 1 97842299 missense probably damaging 1.00
R6112:Pam UTSW 1 97834468 missense probably damaging 0.99
R6513:Pam UTSW 1 97838027 missense possibly damaging 0.60
R6696:Pam UTSW 1 97885727 missense possibly damaging 0.79
R6833:Pam UTSW 1 97837992 missense probably damaging 0.99
R6834:Pam UTSW 1 97837992 missense probably damaging 0.99
R7098:Pam UTSW 1 97898347 missense probably benign
R7117:Pam UTSW 1 97977116 start gained probably benign
R7152:Pam UTSW 1 97885740 missense probably damaging 1.00
R7172:Pam UTSW 1 97834478 missense probably benign 0.10
R7206:Pam UTSW 1 97896032 missense probably damaging 1.00
R7262:Pam UTSW 1 97854723 missense
Predicted Primers PCR Primer
(F):5'- CTGTTGCCTATCTTAATGAAGCATC -3'
(R):5'- AATAAACGTTTGATACCTGCTGGG -3'

Sequencing Primer
(F):5'- TCGAGAAGATATACTTAAGGTCCAGC -3'
(R):5'- GTAATGAAGGAGTGTCCCATTCAC -3'
Posted On2018-08-29