Incidental Mutation 'R6746:Grm6'
ID532847
Institutional Source Beutler Lab
Gene Symbol Grm6
Ensembl Gene ENSMUSG00000000617
Gene Nameglutamate receptor, metabotropic 6
Synonymsnerg1, nob2, mGluR6, nob3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6746 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50850685-50866208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50856963 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 334 (D334V)
Ref Sequence ENSEMBL: ENSMUSP00000130728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000631] [ENSMUST00000171427]
Predicted Effect probably damaging
Transcript: ENSMUST00000000631
AA Change: D334V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000631
Gene: ENSMUSG00000000617
AA Change: D334V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 132 475 1.7e-11 PFAM
Pfam:NCD3G 508 558 5.3e-16 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 589 837 7.2e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171427
AA Change: D334V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130728
Gene: ENSMUSG00000000617
AA Change: D334V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 2.5e-106 PFAM
Pfam:Peripla_BP_6 132 338 6.2e-10 PFAM
Pfam:NCD3G 508 558 4e-13 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 591 836 1.4e-56 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice show loss of ON responses without significant alteration of OFF responses in visual transmission or changes in visual behavioral responses. ENU-induced mutant mice have an ERG that lacks the rod b-wave and scotopic threshold response, while the cone ERG is of large amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Anpep A C 7: 79,839,185 probably null Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Gm5415 A T 1: 32,546,763 I22N probably benign Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hnf4g C A 3: 3,657,110 Y441* probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Ppm1m A T 9: 106,198,152 C99* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rassf6 C A 5: 90,609,774 R109L possibly damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Wdr35 T A 12: 9,003,982 probably null Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Grm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Grm6 APN 11 50863297 splice site probably benign
IGL01305:Grm6 APN 11 50859519 missense probably benign 0.27
IGL02121:Grm6 APN 11 50859656 missense probably damaging 1.00
IGL02413:Grm6 APN 11 50859939 missense probably damaging 0.99
ANU22:Grm6 UTSW 11 50859519 missense probably benign 0.27
R0089:Grm6 UTSW 11 50859965 missense probably damaging 1.00
R0135:Grm6 UTSW 11 50853223 missense probably damaging 0.99
R0147:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R1498:Grm6 UTSW 11 50857256 missense probably damaging 1.00
R1577:Grm6 UTSW 11 50863145 missense probably damaging 1.00
R1666:Grm6 UTSW 11 50859884 missense probably damaging 1.00
R2923:Grm6 UTSW 11 50864521 missense probably damaging 1.00
R4060:Grm6 UTSW 11 50853224 missense probably damaging 1.00
R4486:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4488:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4489:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4646:Grm6 UTSW 11 50857206 missense probably benign 0.03
R4701:Grm6 UTSW 11 50863010 missense probably damaging 1.00
R4785:Grm6 UTSW 11 50857277 missense probably benign 0.00
R4860:Grm6 UTSW 11 50864612 missense probably benign 0.31
R5603:Grm6 UTSW 11 50856959 missense probably damaging 1.00
R6104:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R6791:Grm6 UTSW 11 50859774 missense possibly damaging 0.74
R6802:Grm6 UTSW 11 50853389 missense probably benign 0.24
R6856:Grm6 UTSW 11 50859825 missense probably damaging 1.00
R7102:Grm6 UTSW 11 50862977 missense possibly damaging 0.87
R7221:Grm6 UTSW 11 50863043 missense probably damaging 0.97
X0025:Grm6 UTSW 11 50863095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCAGAGCTGCCATATTCC -3'
(R):5'- TTCATAGGTGGAGTCCTGGC -3'

Sequencing Primer
(F):5'- CTAGAGATCACCGATATGGCTAGTC -3'
(R):5'- AAGTATGCCTGGCCCCTAGAC -3'
Posted On2018-08-29