Incidental Mutation 'R6789:Prpf6'
ID532920
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Namepre-mRNA splicing factor 6
SynonymsANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6789 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181591868-181655660 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 181616051 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 105 (Y105*)
Ref Sequence ENSEMBL: ENSMUSP00000121340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000132714] [ENSMUST00000136481]
Predicted Effect probably null
Transcript: ENSMUST00000002529
AA Change: Y105*
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: Y105*

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000132714
AA Change: Y46*
SMART Domains Protein: ENSMUSP00000117711
Gene: ENSMUSG00000002455
AA Change: Y46*

DomainStartEndE-ValueType
Pfam:PRP1_N 1 54 6e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136481
AA Change: Y105*
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: Y105*

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox2 T A 1: 58,304,485 D442E probably benign Het
Arl6ip4 G A 5: 124,116,602 G53R probably damaging Het
Asns T C 6: 7,675,344 T553A probably benign Het
Atp1a1 T A 3: 101,586,298 N497Y possibly damaging Het
BC005561 T C 5: 104,517,689 F26L probably benign Het
Birc2 T C 9: 7,836,965 probably benign Het
Catsperd C A 17: 56,654,426 probably null Het
Dchs1 G T 7: 105,757,003 Q2341K possibly damaging Het
Dydc2 C A 14: 41,049,339 V128L probably benign Het
Efna3 C T 3: 89,316,462 probably null Het
Fam160a1 A T 3: 85,672,558 L780* probably null Het
Fbn2 C T 18: 58,010,614 E2790K probably benign Het
Gm11569 C A 11: 99,798,831 probably benign Het
Gprc6a C T 10: 51,631,316 G39D probably damaging Het
Igkv6-17 A G 6: 70,371,708 D21G probably benign Het
Klra4 T C 6: 130,062,219 Q70R probably damaging Het
Krtap31-2 C T 11: 99,936,723 S127F possibly damaging Het
Lingo4 G T 3: 94,399,355 probably benign Het
Lrp2bp A G 8: 46,013,114 K87E possibly damaging Het
Macf1 A T 4: 123,372,438 M5333K probably damaging Het
Mmp13 A T 9: 7,272,781 Y47F probably benign Het
Muc16 G A 9: 18,559,986 P7261S probably benign Het
Nostrin G T 2: 69,175,512 M212I probably benign Het
Nr1h5 G A 3: 102,958,361 T8M possibly damaging Het
Nup153 A T 13: 46,717,316 L41H probably damaging Het
Olfr1358 T C 10: 78,519,968 L120P noncoding transcript Het
Olfr1447 T A 19: 12,901,289 I164L probably benign Het
Pappa A T 4: 65,181,041 D599V probably damaging Het
Pcdh18 G A 3: 49,755,915 T317I probably benign Het
Pcsk5 T A 19: 17,456,786 N1406I possibly damaging Het
Pik3c2a A T 7: 116,362,184 Y1027N probably damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rnf8 T A 17: 29,635,869 W433R probably damaging Het
Slc18b1 T A 10: 23,816,329 V232D probably benign Het
Taf11 C A 17: 27,907,518 A52S probably benign Het
Trav9-2 T C 14: 53,591,362 L63P possibly damaging Het
Wdr34 A G 2: 30,033,272 probably null Het
Zfat T C 15: 68,084,386 Y1199C probably damaging Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
IGL02837:Prpf6 UTSW 2 181622263 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6152:Prpf6 UTSW 2 181621787 missense probably damaging 1.00
R6252:Prpf6 UTSW 2 181647363 missense probably damaging 1.00
R6317:Prpf6 UTSW 2 181631436 missense probably benign 0.06
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCTCTAACTGGAATAGCC -3'
(R):5'- CAGGTGCGGCTGTTACAAAC -3'

Sequencing Primer
(F):5'- AACTGGAATAGCCCTTCTGTC -3'
(R):5'- TGCGGCTGTTACAAACTAAGGTC -3'
Posted On2018-08-29