Incidental Mutation 'R6795:2310002L09Rik'
List |< first << previous [record 74 of 18487] next >> last >|
ID532963
Institutional Source Beutler Lab
Gene Symbol 2310002L09Rik
Ensembl Gene ENSMUSG00000028396
Gene NameRIKEN cDNA 2310002L09 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R6795 (G1)
Quality Score95.0077
Status Not validated
Chromosome4
Chromosomal Location73939371-73950846 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 73950828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030101] [ENSMUST00000095023]
Predicted Effect probably benign
Transcript: ENSMUST00000030101
SMART Domains Protein: ENSMUSP00000030101
Gene: ENSMUSG00000028396

DomainStartEndE-ValueType
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095023
SMART Domains Protein: ENSMUSP00000092633
Gene: ENSMUSG00000028396

DomainStartEndE-ValueType
transmembrane domain 174 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in 2310002L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:2310002L09Rik APN 4 73942719 missense possibly damaging 0.66
IGL01366:2310002L09Rik APN 4 73950700 utr 5 prime probably benign
IGL02596:2310002L09Rik APN 4 73950667 missense possibly damaging 0.94
R0841:2310002L09Rik UTSW 4 73942749 missense probably benign
R2919:2310002L09Rik UTSW 4 73950608 missense probably damaging 1.00
R6056:2310002L09Rik UTSW 4 73942878 missense probably benign 0.00
R6889:2310002L09Rik UTSW 4 73943053 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AATGGAGGCTTCGTTGAGTCC -3'
(R):5'- TGAAGCCATACTATCAGAGCCAAG -3'

Sequencing Primer
(F):5'- GTTGAGTCCTGATCTTCACCAAG -3'
(R):5'- GCTGTTTCTTCCATTGTAGAATTAGG -3'
Posted On2018-08-29