Incidental Mutation 'R6797:Cenpe'
ID 533042
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, Kif10, N-7 kinesin, CENP-E
MMRRC Submission 044910-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6797 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 134918324-134979301 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 134943899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 938 (Q938L)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062893
AA Change: Q938L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: Q938L

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,195,276 (GRCm39) I61L probably benign Het
Angptl2 T C 2: 33,118,277 (GRCm39) V17A probably benign Het
Casp14 T C 10: 78,550,975 (GRCm39) D70G possibly damaging Het
Cckbr A G 7: 105,083,773 (GRCm39) M234V possibly damaging Het
Cd93 T C 2: 148,284,044 (GRCm39) N434S probably benign Het
Col6a3 A C 1: 90,731,810 (GRCm39) V1481G probably damaging Het
Dnah5 G T 15: 28,233,384 (GRCm39) E248* probably null Het
Dnah5 G A 15: 28,451,609 (GRCm39) R4349Q probably damaging Het
F11 A G 8: 45,706,092 (GRCm39) Y98H probably benign Het
Fen1 A G 19: 10,178,067 (GRCm39) F126L probably benign Het
Gpr146 G A 5: 139,378,795 (GRCm39) G199D possibly damaging Het
Gramd1b A G 9: 40,219,702 (GRCm39) I324T probably benign Het
H2bc12 A T 13: 22,220,259 (GRCm39) N68I probably benign Het
Hivep1 C A 13: 42,310,557 (GRCm39) S932R probably benign Het
Hk3 A T 13: 55,158,644 (GRCm39) probably null Het
Hspbp1 T A 7: 4,663,781 (GRCm39) M355L possibly damaging Het
Jaml T C 9: 45,000,058 (GRCm39) C77R probably damaging Het
Kmt2e A G 5: 23,687,505 (GRCm39) N452D possibly damaging Het
Krt5 T C 15: 101,621,076 (GRCm39) Y57C unknown Het
Lipn A T 19: 34,058,160 (GRCm39) M294L probably benign Het
Magel2 A G 7: 62,029,907 (GRCm39) E937G unknown Het
Med13l G A 5: 118,897,329 (GRCm39) probably null Het
Mrgprb8 G A 7: 48,038,892 (GRCm39) V188I probably benign Het
Ocln T C 13: 100,676,223 (GRCm39) D90G probably damaging Het
Ofcc1 C T 13: 40,241,423 (GRCm39) R695Q possibly damaging Het
Or11h23 T A 14: 50,948,563 (GRCm39) Y259N probably damaging Het
Or52ab7 G A 7: 102,978,328 (GRCm39) V212I probably benign Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pak5 A T 2: 135,939,454 (GRCm39) H560Q probably damaging Het
Pigg T C 5: 108,480,694 (GRCm39) S493P probably damaging Het
Ppp6r3 A G 19: 3,564,719 (GRCm39) W185R probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Sacs T A 14: 61,450,522 (GRCm39) D4189E probably damaging Het
Serpinb9b A G 13: 33,213,467 (GRCm39) N8S possibly damaging Het
Slit3 A G 11: 35,524,779 (GRCm39) T730A possibly damaging Het
Srgap3 A T 6: 112,806,503 (GRCm39) F53I probably damaging Het
Stc2 T A 11: 31,315,351 (GRCm39) K163* probably null Het
Tasor2 T C 13: 3,626,769 (GRCm39) I1060M probably benign Het
Tlk1 T A 2: 70,568,770 (GRCm39) K411* probably null Het
Ttc27 G T 17: 75,036,883 (GRCm39) L185F probably benign Het
Vmn2r102 C T 17: 19,880,694 (GRCm39) Q12* probably null Het
Vmn2r95 C T 17: 18,672,551 (GRCm39) probably benign Het
Vopp1 A G 6: 57,739,492 (GRCm39) Y19H possibly damaging Het
Wdr64 T A 1: 175,638,176 (GRCm39) probably null Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 134,937,216 (GRCm39) critical splice donor site probably null
IGL00799:Cenpe APN 3 134,934,678 (GRCm39) critical splice donor site probably null
IGL00815:Cenpe APN 3 134,965,112 (GRCm39) missense probably benign
IGL01446:Cenpe APN 3 134,943,300 (GRCm39) missense probably benign 0.01
IGL01469:Cenpe APN 3 134,934,567 (GRCm39) missense probably damaging 1.00
IGL01843:Cenpe APN 3 134,924,268 (GRCm39) missense possibly damaging 0.88
IGL02254:Cenpe APN 3 134,961,238 (GRCm39) missense probably benign
IGL02337:Cenpe APN 3 134,926,037 (GRCm39) splice site probably benign
IGL02382:Cenpe APN 3 134,953,147 (GRCm39) missense probably benign
IGL02458:Cenpe APN 3 134,935,869 (GRCm39) nonsense probably null
IGL02934:Cenpe APN 3 134,970,112 (GRCm39) missense probably damaging 1.00
IGL03335:Cenpe APN 3 134,949,386 (GRCm39) missense probably benign
R0086:Cenpe UTSW 3 134,970,185 (GRCm39) splice site probably benign
R0173:Cenpe UTSW 3 134,965,744 (GRCm39) missense probably benign 0.00
R0394:Cenpe UTSW 3 134,922,186 (GRCm39) splice site probably benign
R0411:Cenpe UTSW 3 134,928,016 (GRCm39) missense probably damaging 1.00
R0624:Cenpe UTSW 3 134,952,347 (GRCm39) missense probably benign 0.00
R0634:Cenpe UTSW 3 134,952,588 (GRCm39) missense probably damaging 1.00
R0648:Cenpe UTSW 3 134,935,843 (GRCm39) missense probably damaging 1.00
R0691:Cenpe UTSW 3 134,923,066 (GRCm39) missense probably damaging 1.00
R1184:Cenpe UTSW 3 134,970,183 (GRCm39) critical splice donor site probably null
R1530:Cenpe UTSW 3 134,952,663 (GRCm39) missense possibly damaging 0.92
R1559:Cenpe UTSW 3 134,976,661 (GRCm39) missense probably benign 0.07
R1562:Cenpe UTSW 3 134,944,155 (GRCm39) missense possibly damaging 0.53
R1568:Cenpe UTSW 3 134,945,519 (GRCm39) missense probably benign 0.01
R1712:Cenpe UTSW 3 134,971,694 (GRCm39) missense probably damaging 0.99
R1828:Cenpe UTSW 3 134,952,257 (GRCm39) missense probably damaging 0.99
R1846:Cenpe UTSW 3 134,945,606 (GRCm39) missense probably damaging 1.00
R1861:Cenpe UTSW 3 134,974,740 (GRCm39) missense probably damaging 1.00
R1938:Cenpe UTSW 3 134,953,240 (GRCm39) missense probably damaging 0.98
R1961:Cenpe UTSW 3 134,948,254 (GRCm39) missense probably damaging 1.00
R2062:Cenpe UTSW 3 134,928,082 (GRCm39) splice site probably benign
R2118:Cenpe UTSW 3 134,952,645 (GRCm39) missense possibly damaging 0.94
R2127:Cenpe UTSW 3 134,945,541 (GRCm39) missense probably benign 0.08
R2156:Cenpe UTSW 3 134,953,235 (GRCm39) missense probably benign 0.34
R2265:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2268:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2392:Cenpe UTSW 3 134,953,874 (GRCm39) missense probably damaging 1.00
R2508:Cenpe UTSW 3 134,946,834 (GRCm39) missense possibly damaging 0.92
R3084:Cenpe UTSW 3 134,946,782 (GRCm39) missense probably damaging 1.00
R3779:Cenpe UTSW 3 134,962,337 (GRCm39) missense possibly damaging 0.87
R3833:Cenpe UTSW 3 134,928,083 (GRCm39) splice site probably benign
R3974:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R3975:Cenpe UTSW 3 134,944,233 (GRCm39) critical splice donor site probably null
R3975:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R4151:Cenpe UTSW 3 134,920,914 (GRCm39) missense probably benign 0.36
R4166:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R4581:Cenpe UTSW 3 134,952,761 (GRCm39) missense probably benign 0.30
R4622:Cenpe UTSW 3 134,949,469 (GRCm39) missense probably benign 0.22
R4692:Cenpe UTSW 3 134,922,140 (GRCm39) missense probably benign 0.29
R4769:Cenpe UTSW 3 134,953,912 (GRCm39) missense probably benign
R4976:Cenpe UTSW 3 134,940,637 (GRCm39) missense probably damaging 1.00
R4983:Cenpe UTSW 3 134,940,689 (GRCm39) missense probably damaging 1.00
R4990:Cenpe UTSW 3 134,962,401 (GRCm39) missense probably damaging 1.00
R5002:Cenpe UTSW 3 134,952,842 (GRCm39) missense probably benign
R5057:Cenpe UTSW 3 134,926,074 (GRCm39) missense probably benign 0.14
R5063:Cenpe UTSW 3 134,976,715 (GRCm39) missense probably damaging 0.99
R5181:Cenpe UTSW 3 134,948,064 (GRCm39) missense probably damaging 0.99
R5281:Cenpe UTSW 3 134,935,911 (GRCm39) missense possibly damaging 0.89
R5389:Cenpe UTSW 3 134,965,149 (GRCm39) critical splice donor site probably null
R5517:Cenpe UTSW 3 134,929,026 (GRCm39) missense probably damaging 1.00
R5521:Cenpe UTSW 3 134,974,826 (GRCm39) missense probably damaging 1.00
R5607:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5608:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5627:Cenpe UTSW 3 134,941,234 (GRCm39) missense possibly damaging 0.51
R5766:Cenpe UTSW 3 134,954,174 (GRCm39) missense probably damaging 0.96
R5783:Cenpe UTSW 3 134,967,341 (GRCm39) missense probably benign 0.00
R5933:Cenpe UTSW 3 134,967,389 (GRCm39) missense probably benign 0.03
R6073:Cenpe UTSW 3 134,965,834 (GRCm39) nonsense probably null
R6163:Cenpe UTSW 3 134,974,764 (GRCm39) missense probably damaging 0.99
R6192:Cenpe UTSW 3 134,954,291 (GRCm39) missense possibly damaging 0.93
R6224:Cenpe UTSW 3 134,949,536 (GRCm39) missense possibly damaging 0.87
R6313:Cenpe UTSW 3 134,935,936 (GRCm39) missense probably benign 0.26
R6326:Cenpe UTSW 3 134,945,539 (GRCm39) missense probably benign 0.15
R6383:Cenpe UTSW 3 134,957,289 (GRCm39) missense probably damaging 1.00
R6418:Cenpe UTSW 3 134,957,305 (GRCm39) missense probably damaging 0.99
R6810:Cenpe UTSW 3 134,949,583 (GRCm39) missense probably benign 0.00
R6989:Cenpe UTSW 3 134,940,888 (GRCm39) missense probably damaging 1.00
R7009:Cenpe UTSW 3 134,940,963 (GRCm39) missense probably benign 0.02
R7009:Cenpe UTSW 3 134,940,962 (GRCm39) missense probably damaging 0.97
R7039:Cenpe UTSW 3 134,961,217 (GRCm39) missense probably benign 0.28
R7387:Cenpe UTSW 3 134,952,798 (GRCm39) missense probably benign 0.05
R7470:Cenpe UTSW 3 134,947,916 (GRCm39) missense probably damaging 1.00
R7535:Cenpe UTSW 3 134,949,523 (GRCm39) missense possibly damaging 0.90
R7562:Cenpe UTSW 3 134,954,395 (GRCm39) missense probably damaging 1.00
R7573:Cenpe UTSW 3 134,953,220 (GRCm39) missense probably damaging 1.00
R7613:Cenpe UTSW 3 134,948,063 (GRCm39) missense possibly damaging 0.90
R7741:Cenpe UTSW 3 134,953,096 (GRCm39) splice site probably null
R7771:Cenpe UTSW 3 134,946,702 (GRCm39) splice site probably null
R7843:Cenpe UTSW 3 134,938,720 (GRCm39) nonsense probably null
R7973:Cenpe UTSW 3 134,929,011 (GRCm39) missense probably damaging 1.00
R8036:Cenpe UTSW 3 134,945,609 (GRCm39) frame shift probably null
R8069:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R8151:Cenpe UTSW 3 134,952,783 (GRCm39) missense probably benign 0.28
R8176:Cenpe UTSW 3 134,935,851 (GRCm39) missense probably damaging 1.00
R8191:Cenpe UTSW 3 134,957,375 (GRCm39) missense probably benign
R8251:Cenpe UTSW 3 134,957,445 (GRCm39) critical splice donor site probably null
R8425:Cenpe UTSW 3 134,948,388 (GRCm39) nonsense probably null
R8488:Cenpe UTSW 3 134,965,002 (GRCm39) missense probably damaging 1.00
R8811:Cenpe UTSW 3 134,929,001 (GRCm39) missense probably damaging 1.00
R8850:Cenpe UTSW 3 134,930,777 (GRCm39) missense probably damaging 1.00
R8879:Cenpe UTSW 3 134,965,862 (GRCm39) missense probably damaging 0.99
R8899:Cenpe UTSW 3 134,945,644 (GRCm39) missense probably benign 0.18
R9035:Cenpe UTSW 3 134,976,572 (GRCm39) missense probably benign 0.01
R9038:Cenpe UTSW 3 134,923,797 (GRCm39) missense probably benign 0.00
R9093:Cenpe UTSW 3 134,945,641 (GRCm39) nonsense probably null
R9221:Cenpe UTSW 3 134,935,839 (GRCm39) missense possibly damaging 0.90
R9365:Cenpe UTSW 3 134,954,207 (GRCm39) missense possibly damaging 0.56
R9443:Cenpe UTSW 3 134,976,609 (GRCm39) missense probably damaging 0.99
Z1177:Cenpe UTSW 3 134,922,146 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTTTCTCACAAGACTCAAGAGC -3'
(R):5'- TTGTTTCAGAGACTCCAGAGC -3'

Sequencing Primer
(F):5'- CTTGAGCAGAAAACAGTTGAGGGTC -3'
(R):5'- GACTCCAGAGCATTTAGTAACTGCTC -3'
Posted On 2018-08-29