Incidental Mutation 'R6798:Frmpd1'
ID533096
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6798 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45284850 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1224 (T1224A)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably benign
Transcript: ENSMUST00000044773
AA Change: T1224A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: T1224A

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107804
AA Change: T1224A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: T1224A

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha6 T G 16: 60,605,064 E62A possibly damaging Het
Epha6 C T 16: 60,605,065 E62K possibly damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Kdm1b A G 13: 47,068,536 T484A probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr504 T A 7: 108,565,760 K12* probably null Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Olfr96 T G 17: 37,225,806 L227R probably damaging Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prkd2 A T 7: 16,849,203 K297* probably null Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Snx25 T C 8: 46,033,773 H977R probably damaging Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACCTCATCTGACTCTGAAGGGG -3'
(R):5'- ACTTCGTTTATGCCAGCAAAAC -3'

Sequencing Primer
(F):5'- CTCATCTGACTCTGAAGGGGAAAAC -3'
(R):5'- AGGTGACCCTGCTGAGACTG -3'
Posted On2018-08-29