Incidental Mutation 'R6799:Clca4b'
ID533188
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6799 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 144915627 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably null
Transcript: ENSMUST00000098549
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A T 5: 145,044,814 Y153F probably damaging Het
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk1 A G 13: 60,752,235 N878S probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lpin1 T A 12: 16,561,044 N516Y probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Nlrp14 A G 7: 107,196,139 I210V probably benign Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Pygm A T 19: 6,398,127 Y733F probably damaging Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATACACAATCATTGGGC -3'
(R):5'- ACCTGAGGAATCAAGACCTTTC -3'

Sequencing Primer
(F):5'- CATACACAATCATTGGGCTGGGG -3'
(R):5'- TCCAATAGCTGACTGTGAGC -3'
Posted On2018-09-12