Incidental Mutation 'R6799:Nlrp14'
ID533204
Institutional Source Beutler Lab
Gene Symbol Nlrp14
Ensembl Gene ENSMUSG00000016626
Gene NameNLR family, pyrin domain containing 14
Synonyms4921520L01Rik, GC-LRR, Nalp-iota, Nalp14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6799 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107166990-107198102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107196139 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 210 (I210V)
Ref Sequence ENSEMBL: ENSMUSP00000145427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084763] [ENSMUST00000142623]
Predicted Effect probably benign
Transcript: ENSMUST00000084763
AA Change: I869V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081819
Gene: ENSMUSG00000016626
AA Change: I869V

DomainStartEndE-ValueType
Pfam:NACHT 81 249 1.6e-38 PFAM
Blast:LRR 574 601 4e-6 BLAST
LRR 629 656 1.67e0 SMART
LRR 658 685 1.56e0 SMART
LRR 686 713 2.05e-2 SMART
LRR 715 742 7.9e-4 SMART
LRR 743 770 1.25e-1 SMART
LRR 772 799 4.68e-1 SMART
LRR 800 827 9.08e-4 SMART
LRR 829 856 1.59e1 SMART
LRR 857 884 7.15e-1 SMART
LRR 886 913 6.57e0 SMART
LRR 914 941 3.36e1 SMART
low complexity region 953 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142623
AA Change: I210V

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145427
Gene: ENSMUSG00000016626
AA Change: I210V

DomainStartEndE-ValueType
LRR 27 54 9.1e-5 SMART
LRR 56 83 3.4e-6 SMART
LRR 84 111 5.4e-4 SMART
LRR 113 140 2e-3 SMART
LRR 141 168 4e-6 SMART
LRR 170 197 6.7e-2 SMART
LRR 198 225 3.1e-3 SMART
LRR 227 254 2.8e-2 SMART
LRR 255 282 1.4e-1 SMART
low complexity region 294 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A T 5: 145,044,814 Y153F probably damaging Het
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Clca4b A T 3: 144,915,627 probably null Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk1 A G 13: 60,752,235 N878S probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lpin1 T A 12: 16,561,044 N516Y probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Pygm A T 19: 6,398,127 Y733F probably damaging Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in Nlrp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Nlrp14 APN 7 107192502 missense possibly damaging 0.91
IGL00337:Nlrp14 APN 7 107182101 missense possibly damaging 0.95
IGL00587:Nlrp14 APN 7 107181767 missense probably benign 0.10
IGL00654:Nlrp14 APN 7 107196144 missense probably damaging 1.00
IGL00712:Nlrp14 APN 7 107197241 missense probably damaging 1.00
IGL00765:Nlrp14 APN 7 107190139 missense possibly damaging 0.85
IGL01392:Nlrp14 APN 7 107197913 utr 3 prime probably benign
IGL02325:Nlrp14 APN 7 107182316 missense possibly damaging 0.95
IGL02572:Nlrp14 APN 7 107182722 nonsense probably null
IGL03180:Nlrp14 APN 7 107182626 missense probably benign 0.01
IGL03186:Nlrp14 APN 7 107186670 missense probably damaging 0.98
PIT4403001:Nlrp14 UTSW 7 107184892 missense possibly damaging 0.65
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0148:Nlrp14 UTSW 7 107182721 missense probably benign
R0720:Nlrp14 UTSW 7 107182013 missense probably benign 0.19
R0842:Nlrp14 UTSW 7 107183135 missense probably benign 0.08
R1367:Nlrp14 UTSW 7 107182811 missense probably benign 0.01
R1472:Nlrp14 UTSW 7 107182703 missense probably benign 0.33
R1483:Nlrp14 UTSW 7 107190122 missense possibly damaging 0.84
R1615:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
R1991:Nlrp14 UTSW 7 107196200 missense probably benign 0.21
R2171:Nlrp14 UTSW 7 107182502 missense probably damaging 0.99
R2287:Nlrp14 UTSW 7 107182662 missense probably damaging 1.00
R2394:Nlrp14 UTSW 7 107197824 missense probably benign 0.13
R3151:Nlrp14 UTSW 7 107182552 missense probably benign 0.32
R3732:Nlrp14 UTSW 7 107182367 missense probably benign 0.00
R3793:Nlrp14 UTSW 7 107182274 missense probably benign 0.00
R4368:Nlrp14 UTSW 7 107197805 missense probably benign 0.01
R4652:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R4772:Nlrp14 UTSW 7 107181186 missense probably benign 0.07
R4886:Nlrp14 UTSW 7 107182655 missense probably benign 0.02
R4896:Nlrp14 UTSW 7 107197179 frame shift probably null
R4910:Nlrp14 UTSW 7 107186583 missense possibly damaging 0.93
R5925:Nlrp14 UTSW 7 107186653 missense probably benign 0.35
R5997:Nlrp14 UTSW 7 107182496 missense probably benign 0.11
R6192:Nlrp14 UTSW 7 107182439 missense probably benign 0.00
R6230:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R7116:Nlrp14 UTSW 7 107183048 missense possibly damaging 0.86
R7131:Nlrp14 UTSW 7 107184814 missense possibly damaging 0.47
R7387:Nlrp14 UTSW 7 107183107 missense probably damaging 0.98
X0019:Nlrp14 UTSW 7 107182927 missense probably benign 0.11
X0050:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
Z1088:Nlrp14 UTSW 7 107186622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTTATGTCCTGGGTTGTAC -3'
(R):5'- GCAAAAGGCATATAATATACAGGCC -3'

Sequencing Primer
(F):5'- AAAGGTTTAACTGCCTGGGC -3'
(R):5'- GGCCCATATATTTGAAATTCTGATCC -3'
Posted On2018-09-12