Incidental Mutation 'R6799:Dapk1'
ID533227
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6799 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60752235 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 878 (N878S)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: N878S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: N878S

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: N878S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: N878S

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: N878S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A T 5: 145,044,814 Y153F probably damaging Het
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Clca4b A T 3: 144,915,627 probably null Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lpin1 T A 12: 16,561,044 N516Y probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Nlrp14 A G 7: 107,196,139 I210V probably benign Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Pygm A T 19: 6,398,127 Y733F probably damaging Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60696395 missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60761785 missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60754210 missense probably benign 0.02
R7203:Dapk1 UTSW 13 60696335 missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60719641 missense probably benign 0.00
R7448:Dapk1 UTSW 13 60751176 missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60757497 missense probably benign 0.18
R7532:Dapk1 UTSW 13 60730886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCTAGTGGAGGATCAGGAC -3'
(R):5'- TTTCCAGCAGCATGCCACTG -3'

Sequencing Primer
(F):5'- CCAGGGGCCACACTCTATAATGTG -3'
(R):5'- AGCATGCCACTGTCACCTG -3'
Posted On2018-09-12