Incidental Mutation 'R6800:Fdps'
ID533256
Institutional Source Beutler Lab
Gene Symbol Fdps
Ensembl Gene ENSMUSG00000059743
Gene Namefarnesyl diphosphate synthetase
Synonyms6030492I17Rik, Fdpsl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R6800 (G1)
Quality Score221.009
Status Validated
Chromosome3
Chromosomal Location89093588-89101959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89100761 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 17 (F17V)
Ref Sequence ENSEMBL: ENSMUSP00000142393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081848] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect probably damaging
Transcript: ENSMUST00000081848
AA Change: F17V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743
AA Change: F17V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196709
AA Change: F17V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743
AA Change: F17V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196921
AA Change: F84V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743
AA Change: F84V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199668
AA Change: F17V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743
AA Change: F17V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200659
AA Change: F84V

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: F84V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Fdps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Fdps APN 3 89094442 splice site probably benign
IGL01364:Fdps APN 3 89094270 nonsense probably null
R0245:Fdps UTSW 3 89093771 missense possibly damaging 0.84
R0385:Fdps UTSW 3 89094894 missense probably damaging 1.00
R1674:Fdps UTSW 3 89100730 missense probably benign 0.33
R1820:Fdps UTSW 3 89095043 missense probably benign
R4467:Fdps UTSW 3 89100786 missense possibly damaging 0.71
R5106:Fdps UTSW 3 89099403 missense probably damaging 0.99
R5700:Fdps UTSW 3 89095649 missense probably damaging 1.00
R6128:Fdps UTSW 3 89099433 missense possibly damaging 0.77
R6791:Fdps UTSW 3 89095352 critical splice donor site probably null
R6812:Fdps UTSW 3 89094476 missense possibly damaging 0.51
R6927:Fdps UTSW 3 89093651 missense probably benign 0.41
X0060:Fdps UTSW 3 89094314 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GGTAGTCACTTCGCTCTTATCG -3'
(R):5'- GCTTGGTTTCCTACAACGACC -3'

Sequencing Primer
(F):5'- GTAGTCACTTCGCTCTTATCGAAACC -3'
(R):5'- CTCCCTGGCATATGGGTGTC -3'
Posted On2018-09-12