Incidental Mutation 'R6800:Pianp'
ID533262
Institutional Source Beutler Lab
Gene Symbol Pianp
Ensembl Gene ENSMUSG00000030329
Gene NamePILR alpha associated neural protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124996694-125003096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 125001602 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 257 (P257T)
Ref Sequence ENSEMBL: ENSMUSP00000123940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032479] [ENSMUST00000159391] [ENSMUST00000160666] [ENSMUST00000160704] [ENSMUST00000161292] [ENSMUST00000162000] [ENSMUST00000162170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032479
AA Change: P257T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032479
Gene: ENSMUSG00000030329
AA Change: P257T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159391
SMART Domains Protein: ENSMUSP00000124024
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 165 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160666
SMART Domains Protein: ENSMUSP00000125328
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
Pfam:AJAP1_PANP_C 4 63 5.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160704
AA Change: P257T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124160
Gene: ENSMUSG00000030329
AA Change: P257T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161292
SMART Domains Protein: ENSMUSP00000125600
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162000
AA Change: P257T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145297
Gene: ENSMUSG00000030329
AA Change: P257T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 130 240 3.3e-8 PFAM
low complexity region 251 264 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162170
AA Change: P257T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123940
Gene: ENSMUSG00000030329
AA Change: P257T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 131 240 6.5e-12 PFAM
low complexity region 251 264 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand for the paired immunoglobin-like type 2 receptor alpha, and so may be involved in immune regulation. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Pianp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Pianp APN 6 125000683 missense possibly damaging 0.71
IGL02693:Pianp APN 6 125001635 missense possibly damaging 0.53
R0015:Pianp UTSW 6 125001540 missense probably damaging 1.00
R2208:Pianp UTSW 6 124999639 missense probably damaging 1.00
R6470:Pianp UTSW 6 124999269 unclassified probably benign
R6755:Pianp UTSW 6 124999384 missense probably benign 0.33
R6964:Pianp UTSW 6 124999390 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTATGATGCACAAGCTGGGACC -3'
(R):5'- TTGGAGAGGATCTGACCAGC -3'

Sequencing Primer
(F):5'- ACAAGCTGGGACCGTAGC -3'
(R):5'- GATCTGACCAGCCCCCTTG -3'
Posted On2018-09-12