Incidental Mutation 'R6800:Arrb2'
ID533290
Institutional Source Beutler Lab
Gene Symbol Arrb2
Ensembl Gene ENSMUSG00000060216
Gene Namearrestin, beta 2
Synonymsbeta arr2, beta-arrestin-2, beta-arrestin2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70432635-70440828 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 70437316 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 52 (G52*)
Ref Sequence ENSEMBL: ENSMUSP00000136978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079056] [ENSMUST00000084954] [ENSMUST00000102563] [ENSMUST00000102564] [ENSMUST00000108568] [ENSMUST00000124943] [ENSMUST00000128748] [ENSMUST00000150076]
Predicted Effect probably null
Transcript: ENSMUST00000079056
AA Change: G142*
SMART Domains Protein: ENSMUSP00000078065
Gene: ENSMUSG00000060216
AA Change: G142*

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 8.3e-37 PFAM
Arrestin_C 195 350 5.2e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084954
AA Change: G127*
SMART Domains Protein: ENSMUSP00000082018
Gene: ENSMUSG00000060216
AA Change: G127*

DomainStartEndE-ValueType
Pfam:Arrestin_N 36 160 1.7e-25 PFAM
Arrestin_C 180 335 6.53e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102563
AA Change: G142*
SMART Domains Protein: ENSMUSP00000099623
Gene: ENSMUSG00000060216
AA Change: G142*

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 1.5e-36 PFAM
Arrestin_C 195 350 6.53e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102564
AA Change: G142*
SMART Domains Protein: ENSMUSP00000099624
Gene: ENSMUSG00000060216
AA Change: G142*

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 1.5e-36 PFAM
Arrestin_C 195 350 6.53e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108568
AA Change: G142*
SMART Domains Protein: ENSMUSP00000104208
Gene: ENSMUSG00000060216
AA Change: G142*

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 2.6e-34 PFAM
Arrestin_C 195 350 5.1e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124943
AA Change: G52*
SMART Domains Protein: ENSMUSP00000136978
Gene: ENSMUSG00000060216
AA Change: G52*

DomainStartEndE-ValueType
Pfam:Arrestin_N 4 83 6.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128748
Predicted Effect probably benign
Transcript: ENSMUST00000150076
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced morphine analgesia, an enhanced inflammatory response and reduced threshold to lethal endotoxin challenge, and impaired T and B lymphocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Arrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Arrb2 APN 11 70436871 missense probably damaging 0.99
IGL02484:Arrb2 APN 11 70439474 missense probably damaging 0.99
IGL02550:Arrb2 APN 11 70436870 missense probably damaging 0.96
IGL03375:Arrb2 APN 11 70436179 missense probably damaging 1.00
FR4340:Arrb2 UTSW 11 70438671 missense probably damaging 1.00
FR4342:Arrb2 UTSW 11 70438671 missense probably damaging 1.00
FR4589:Arrb2 UTSW 11 70438671 missense probably damaging 1.00
R1663:Arrb2 UTSW 11 70437603 missense probably damaging 1.00
R1903:Arrb2 UTSW 11 70437982 missense probably damaging 1.00
R4906:Arrb2 UTSW 11 70439899 missense probably benign 0.20
R5389:Arrb2 UTSW 11 70438658 missense probably damaging 0.97
R6498:Arrb2 UTSW 11 70439549 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGACCTGCATGTACCTGG -3'
(R):5'- AGCCAATTCAGATTCCTACCTC -3'

Sequencing Primer
(F):5'- TCTGTGCACTGCCATGAG -3'
(R):5'- AGATTCCTACCTCCCACTGGG -3'
Posted On2018-09-12