Incidental Mutation 'R6800:Zfp72'
ID533297
Institutional Source Beutler Lab
Gene Symbol Zfp72
Ensembl Gene ENSMUSG00000069184
Gene Namezinc finger protein 72
SynonymsZfp74
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74369326-74390836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74371961 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 333 (S333G)
Ref Sequence ENSEMBL: ENSMUSP00000152502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091481] [ENSMUST00000223163]
Predicted Effect probably benign
Transcript: ENSMUST00000091481
AA Change: S333G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000089063
Gene: ENSMUSG00000069184
AA Change: S333G

DomainStartEndE-ValueType
KRAB 1 32 3.57e-1 SMART
ZnF_C2H2 48 70 5.42e-2 SMART
ZnF_C2H2 76 98 1.18e-2 SMART
ZnF_C2H2 104 126 2.05e-2 SMART
ZnF_C2H2 132 154 2.3e-5 SMART
ZnF_C2H2 160 181 2.45e0 SMART
ZnF_C2H2 187 209 1.92e-2 SMART
ZnF_C2H2 215 237 5.59e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 4.94e-5 SMART
ZnF_C2H2 299 321 9.08e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
ZnF_C2H2 355 377 3.16e-3 SMART
ZnF_C2H2 383 405 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223163
AA Change: S333G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Other mutations in Zfp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Zfp72 UTSW 13 74372071 missense probably damaging 1.00
R0711:Zfp72 UTSW 13 74376425 splice site probably benign
R1498:Zfp72 UTSW 13 74372617 missense probably benign 0.01
R4032:Zfp72 UTSW 13 74372330 missense possibly damaging 0.62
R4629:Zfp72 UTSW 13 74372393 missense probably damaging 1.00
R6111:Zfp72 UTSW 13 74372385 missense probably benign 0.31
R6130:Zfp72 UTSW 13 74372341 missense possibly damaging 0.75
R6277:Zfp72 UTSW 13 74372524 nonsense probably null
R6909:Zfp72 UTSW 13 74371742 missense possibly damaging 0.47
R7298:Zfp72 UTSW 13 74372394 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCATCTCTGCATTTATAGGGTTAC -3'
(R):5'- ACAAATGCAGCGAATGTGGC -3'

Sequencing Primer
(F):5'- TTCCCAGAATCTTCACAGCTGTAGAG -3'
(R):5'- TGCAGCGAATGTGGCAAAGC -3'
Posted On2018-09-12