Incidental Mutation 'R6800:Rps6ka2'
ID533305
Institutional Source Beutler Lab
Gene Symbol Rps6ka2
Ensembl Gene ENSMUSG00000023809
Gene Nameribosomal protein S6 kinase, polypeptide 2
SynonymsRps6ka-rs1, pp90rsk, p90rsk, D17Wsu134e, 90kDa, Rsk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R6800 (G1)
Quality Score195.009
Status Validated
Chromosome17
Chromosomal Location7170115-7303315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7251636 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 186 (K186Q)
Ref Sequence ENSEMBL: ENSMUSP00000024575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024575] [ENSMUST00000232527]
Predicted Effect probably damaging
Transcript: ENSMUST00000024575
AA Change: K186Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024575
Gene: ENSMUSG00000023809
AA Change: K186Q

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
S_TKc 59 318 6.25e-107 SMART
S_TK_X 319 380 3.36e-20 SMART
S_TKc 415 672 1.84e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232527
AA Change: K152Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains two non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternative splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased response of heart to stress following transverse aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Rps6ka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Rps6ka2 APN 17 7236124 missense probably benign 0.02
IGL02199:Rps6ka2 APN 17 7254453 splice site probably benign
IGL02458:Rps6ka2 APN 17 7289003 missense probably benign 0.04
IGL02532:Rps6ka2 APN 17 7255966 missense probably damaging 1.00
IGL02741:Rps6ka2 APN 17 7296016 missense probably benign 0.22
IGL02860:Rps6ka2 APN 17 7282856 missense possibly damaging 0.68
IGL02948:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03037:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03085:Rps6ka2 APN 17 7295280 critical splice donor site probably null
IGL03302:Rps6ka2 APN 17 7299388 missense possibly damaging 0.83
IGL03303:Rps6ka2 APN 17 7228012 nonsense probably null
R0083:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0108:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0145:Rps6ka2 UTSW 17 7262186 missense probably benign 0.09
R0257:Rps6ka2 UTSW 17 7227983 missense probably damaging 1.00
R0355:Rps6ka2 UTSW 17 7271610 missense probably benign 0.03
R0563:Rps6ka2 UTSW 17 7254437 missense probably damaging 1.00
R1065:Rps6ka2 UTSW 17 7281758 splice site probably benign
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1540:Rps6ka2 UTSW 17 7292906 missense probably null 1.00
R1708:Rps6ka2 UTSW 17 7277530 missense probably damaging 0.99
R2418:Rps6ka2 UTSW 17 7299339 missense possibly damaging 0.76
R2697:Rps6ka2 UTSW 17 7300322 missense probably benign 0.07
R4427:Rps6ka2 UTSW 17 7299405 missense possibly damaging 0.90
R4753:Rps6ka2 UTSW 17 7299308 missense possibly damaging 0.86
R4951:Rps6ka2 UTSW 17 7292789 missense probably damaging 1.00
R4954:Rps6ka2 UTSW 17 7271604 missense probably benign 0.00
R4954:Rps6ka2 UTSW 17 7299286 missense probably benign
R6298:Rps6ka2 UTSW 17 7170367 missense possibly damaging 0.92
R6905:Rps6ka2 UTSW 17 7227941 missense probably damaging 1.00
R6952:Rps6ka2 UTSW 17 7227978 missense probably benign 0.00
R7014:Rps6ka2 UTSW 17 7255932 missense probably benign 0.29
R7268:Rps6ka2 UTSW 17 7295263 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGGCTTCTTTGAGGAGACC -3'
(R):5'- ATGAATGAAGGCCCCACATC -3'

Sequencing Primer
(F):5'- TTGAGGAGACCTTTGCAACATGC -3'
(R):5'- ATGAAGGCCCCACATCTGCTG -3'
Posted On2018-09-12