Incidental Mutation 'R6800:Olfr134'
ID533306
Institutional Source Beutler Lab
Gene Symbol Olfr134
Ensembl Gene ENSMUSG00000096009
Gene Nameolfactory receptor 134
SynonymsMOR256-5, GA_x6K02T2PSCP-2623613-2624551
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location38171388-38176578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38175122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 13 (I13V)
Ref Sequence ENSEMBL: ENSMUSP00000151069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074883] [ENSMUST00000215900]
Predicted Effect probably benign
Transcript: ENSMUST00000074883
AA Change: I13V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074423
Gene: ENSMUSG00000096009
AA Change: I13V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-50 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215900
AA Change: I13V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Olfr134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Olfr134 APN 17 38175875 missense probably damaging 1.00
IGL01749:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01750:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01751:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01753:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01757:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01765:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01766:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01767:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01822:Olfr134 APN 17 38175448 missense probably damaging 1.00
IGL02256:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02257:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02258:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02259:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02275:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02293:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02295:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02317:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02318:Olfr134 APN 17 38175686 missense probably benign 0.04
R0230:Olfr134 UTSW 17 38175950 missense probably damaging 1.00
R0363:Olfr134 UTSW 17 38175447 missense probably damaging 1.00
R1074:Olfr134 UTSW 17 38175440 missense probably damaging 1.00
R1506:Olfr134 UTSW 17 38175200 missense probably benign
R2300:Olfr134 UTSW 17 38175550 nonsense probably null
R3743:Olfr134 UTSW 17 38175902 missense probably damaging 1.00
R3975:Olfr134 UTSW 17 38175495 missense probably benign 0.03
R4230:Olfr134 UTSW 17 38175881 missense possibly damaging 0.67
R5158:Olfr134 UTSW 17 38175454 nonsense probably null
R5439:Olfr134 UTSW 17 38176026 unclassified probably null
R6144:Olfr134 UTSW 17 38175225 missense probably damaging 1.00
R6309:Olfr134 UTSW 17 38175519 missense probably benign 0.00
R6675:Olfr134 UTSW 17 38176014 missense probably benign
R6873:Olfr134 UTSW 17 38175368 missense probably benign
R7193:Olfr134 UTSW 17 38175096 missense probably benign 0.44
X0011:Olfr134 UTSW 17 38175851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACAAAGCTCTATATGGACTG -3'
(R):5'- CATCTGAGGTACAATGCTTGTG -3'

Sequencing Primer
(F):5'- ATGGACTGATGTGTCTCCTAAC -3'
(R):5'- TGTGGTGTAGCACATGTCTAGAAAG -3'
Posted On2018-09-12