Incidental Mutation 'R6801:Rftn2'
ID533313
Institutional Source Beutler Lab
Gene Symbol Rftn2
Ensembl Gene ENSMUSG00000025978
Gene Nameraftlin family member 2
Synonyms3222401M22Rik, 2700010E02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028713.1; Ensembl: ENSMUST00000027121, ENSMUST00000114428

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6801 (G1)
Quality Score201.009
Status Validated
Chromosome1
Chromosomal Location55170159-55226782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55194259 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 379 (I379T)
Ref Sequence ENSEMBL: ENSMUSP00000027121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027121] [ENSMUST00000132055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027121
AA Change: I379T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027121
Gene: ENSMUSG00000025978
AA Change: I379T

DomainStartEndE-ValueType
Pfam:Raftlin 1 439 2e-180 PFAM
low complexity region 467 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132055
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Rftn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Rftn2 APN 1 55204285 missense probably damaging 1.00
IGL01691:Rftn2 APN 1 55214286 missense probably damaging 1.00
IGL02412:Rftn2 APN 1 55206338 missense probably benign 0.01
IGL02458:Rftn2 APN 1 55211192 nonsense probably null
1mM(1):Rftn2 UTSW 1 55206595 missense possibly damaging 0.94
R0446:Rftn2 UTSW 1 55214195 missense probably damaging 0.99
R1167:Rftn2 UTSW 1 55204299 missense probably damaging 1.00
R1172:Rftn2 UTSW 1 55211217 missense probably damaging 0.99
R4171:Rftn2 UTSW 1 55214270 missense probably damaging 1.00
R4350:Rftn2 UTSW 1 55194281 missense probably damaging 1.00
R4487:Rftn2 UTSW 1 55202152 missense possibly damaging 0.74
R4833:Rftn2 UTSW 1 55214240 missense possibly damaging 0.56
R4863:Rftn2 UTSW 1 55172039 missense probably benign 0.01
R5719:Rftn2 UTSW 1 55214286 missense probably damaging 1.00
R6937:Rftn2 UTSW 1 55194349 critical splice acceptor site probably null
R6939:Rftn2 UTSW 1 55194349 critical splice acceptor site probably null
R7344:Rftn2 UTSW 1 55226152 nonsense probably null
R7401:Rftn2 UTSW 1 55194242 critical splice donor site probably null
R7517:Rftn2 UTSW 1 55195549 missense probably damaging 1.00
X0022:Rftn2 UTSW 1 55214136 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTATTTGAGGCCCTTGGGAC -3'
(R):5'- CCATGACACTGTTCCACTGGAC -3'

Sequencing Primer
(F):5'- GGACAATACCAATGACAGGGACC -3'
(R):5'- CACACTACAACACTCATCAGCC -3'
Posted On2018-09-12