Incidental Mutation 'R6801:Suv39h2'
ID533318
Institutional Source Beutler Lab
Gene Symbol Suv39h2
Ensembl Gene ENSMUSG00000026646
Gene Namesuppressor of variegation 3-9 2
SynonymsSuv39h histone methyltransferase, 4930507K23Rik, D2Ertd544e, KMT1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location3455815-3475031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3464421 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 299 (R299K)
Ref Sequence ENSEMBL: ENSMUSP00000027956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027956] [ENSMUST00000060618] [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000115066] [ENSMUST00000127540]
Predicted Effect probably benign
Transcript: ENSMUST00000027956
AA Change: R299K

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027956
Gene: ENSMUSG00000026646
AA Change: R299K

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
CHROMO 117 169 2.44e-11 SMART
Pfam:Pre-SET 212 309 4.4e-18 PFAM
SET 317 446 4.05e-41 SMART
PostSET 461 477 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060618
SMART Domains Protein: ENSMUSP00000054169
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
SET 70 226 6.61e-23 SMART
PostSET 241 257 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061852
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000098026
Gene: ENSMUSG00000026646
AA Change: R196K

DomainStartEndE-ValueType
CHROMO 6 67 2e-7 SMART
Pfam:Pre-SET 110 207 1.3e-17 PFAM
SET 215 344 4.05e-41 SMART
PostSET 359 375 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100463
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115066
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127540
SMART Domains Protein: ENSMUSP00000125485
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Less than 5% of mice either heterozygous or homozygous for a reporter/null allele develop late-onset B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Suv39h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Suv39h2 APN 2 3464259 splice site probably benign
IGL03408:Suv39h2 APN 2 3459876 missense probably damaging 1.00
R0060:Suv39h2 UTSW 2 3464916 missense probably damaging 1.00
R0060:Suv39h2 UTSW 2 3464916 missense probably damaging 1.00
R0511:Suv39h2 UTSW 2 3472579 missense probably damaging 0.99
R1892:Suv39h2 UTSW 2 3459768 missense probably damaging 1.00
R1919:Suv39h2 UTSW 2 3464316 missense probably damaging 1.00
R3888:Suv39h2 UTSW 2 3464808 missense probably benign 0.09
R5583:Suv39h2 UTSW 2 3474853 unclassified probably benign
R6770:Suv39h2 UTSW 2 3472551 missense possibly damaging 0.52
X0062:Suv39h2 UTSW 2 3464785 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATTTCTACATATCCGCAAATGAC -3'
(R):5'- ATTAACGAGTACAGGCCAGC -3'

Sequencing Primer
(F):5'- TCTACATATCCGCAAATGACAACATC -3'
(R):5'- GCTCCCGGGATCAGCATAAAC -3'
Posted On2018-09-12