Incidental Mutation 'R6801:Olfr27'
ID533342
Institutional Source Beutler Lab
Gene Symbol Olfr27
Ensembl Gene ENSMUSG00000049708
Gene Nameolfactory receptor 27
SynonymsMOR171-6, GA_x6K02T2PVTD-32841223-32842158, MTPCR56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39128131-39145072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39144210 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 37 (I37F)
Ref Sequence ENSEMBL: ENSMUSP00000150009 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000214052
AA Change: I37F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216405
AA Change: I37F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Olfr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr27 APN 9 39144757 missense possibly damaging 0.94
IGL00905:Olfr27 APN 9 39145030 missense probably damaging 1.00
IGL02346:Olfr27 APN 9 39144643 missense probably damaging 1.00
R0117:Olfr27 UTSW 9 39144850 missense probably damaging 1.00
R0118:Olfr27 UTSW 9 39144103 start codon destroyed probably null 0.97
R0590:Olfr27 UTSW 9 39144721 missense probably benign 0.01
R2915:Olfr27 UTSW 9 39144466 missense possibly damaging 0.94
R4299:Olfr27 UTSW 9 39144999 missense probably benign 0.11
R4367:Olfr27 UTSW 9 39144429 missense probably damaging 0.98
R4663:Olfr27 UTSW 9 39144849 missense probably damaging 0.97
R5276:Olfr27 UTSW 9 39144315 missense probably damaging 1.00
R5503:Olfr27 UTSW 9 39144484 missense probably benign 0.02
R5742:Olfr27 UTSW 9 39144678 missense probably benign 0.07
R5986:Olfr27 UTSW 9 39144982 missense probably null 1.00
R7247:Olfr27 UTSW 9 39144857 nonsense probably null
R7520:Olfr27 UTSW 9 39144118 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTAGGATATCTTTGCACAC -3'
(R):5'- AGCTGAGCCATACATCCAGAG -3'

Sequencing Primer
(F):5'- ACATGCGGACTTTTTGTACAAG -3'
(R):5'- CCAGAGTAAGAGATGATGTTCTTCTC -3'
Posted On2018-09-12