Incidental Mutation 'R6804:Gne'
ID533476
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6804 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44060210 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 61 (I61T)
Ref Sequence ENSEMBL: ENSMUSP00000133440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000128439] [ENSMUST00000133709] [ENSMUST00000140724] [ENSMUST00000144985] [ENSMUST00000172533] [ENSMUST00000173234] [ENSMUST00000173274] [ENSMUST00000173383]
Predicted Effect probably damaging
Transcript: ENSMUST00000030201
AA Change: I92T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: I92T

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102936
AA Change: I61T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: I61T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128439
AA Change: I86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect probably damaging
Transcript: ENSMUST00000140724
AA Change: I86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000144985
AA Change: I100T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479
AA Change: I100T

DomainStartEndE-ValueType
Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172533
AA Change: I61T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: I61T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173234
AA Change: I61T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: I61T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173274
AA Change: I61T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134406
Gene: ENSMUSG00000028479
AA Change: I61T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 292 2.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173383
AA Change: I61T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133440
Gene: ENSMUSG00000028479
AA Change: I61T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 133 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174522
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,869,047 T110A possibly damaging Het
Aox2 A T 1: 58,304,598 Q480L probably benign Het
Arid4b T A 13: 14,129,207 D72E probably benign Het
Avil C T 10: 127,008,306 Q245* probably null Het
BC048679 T C 7: 81,496,864 S2G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1d T C 14: 30,051,665 T1723A probably benign Het
Chil3 A T 3: 106,164,179 Y56* probably null Het
Clec2i A G 6: 128,895,421 E172G probably damaging Het
Crybg1 C T 10: 43,966,341 D1785N probably damaging Het
Csmd1 G A 8: 16,037,246 R1930W probably damaging Het
D430041D05Rik A C 2: 104,149,026 S2019A possibly damaging Het
Ep300 T A 15: 81,641,311 Y1445* probably null Het
Ifit3b A T 19: 34,611,547 Q41L possibly damaging Het
Llgl2 A G 11: 115,843,315 probably null Het
Maats1 T C 16: 38,332,242 D202G probably damaging Het
Mast3 T C 8: 70,786,732 I417V probably benign Het
Mettl21e T A 1: 44,218,135 I8F probably benign Het
Ms4a2 A G 19: 11,617,535 Y183H probably damaging Het
Naip6 C G 13: 100,299,167 E949D probably benign Het
Nbea T C 3: 56,087,453 T181A probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfm3 A T 3: 115,122,679 Y400F probably benign Het
Olfr102 A G 17: 37,314,130 S85P probably damaging Het
Olfr1391 A G 11: 49,327,981 D190G probably benign Het
Olfr393 A G 11: 73,847,414 V237A probably benign Het
Olfr447 A T 6: 42,911,918 T132S probably benign Het
Pappa2 T C 1: 158,936,868 S358G probably benign Het
Pde4dip C A 3: 97,793,248 E259* probably null Het
Phlpp2 T A 8: 109,928,565 L664Q probably damaging Het
Prpf8 A G 11: 75,499,809 K1262R possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 GGCTTGCACGCCGT G 7: 46,699,640 probably null Het
Sec31a C T 5: 100,382,812 V701I probably benign Het
Smarca2 A T 19: 26,751,886 R12S possibly damaging Het
Spocd1 T A 4: 129,953,630 C537* probably null Het
Syt14 T C 1: 192,901,853 E701G probably damaging Het
Taf3 T C 2: 9,918,217 Y32C possibly damaging Het
Tfeb T C 17: 47,789,810 probably null Het
Ttc13 C A 8: 124,699,687 R168L probably damaging Het
Vmn2r11 T A 5: 109,053,484 N385Y probably damaging Het
Vmn2r54 T C 7: 12,629,865 K367R probably benign Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 intron probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCGTCAAATCGGTCTC -3'
(R):5'- GAAGGCTTTCTCTTGATCCGAG -3'

Sequencing Primer
(F):5'- CTCCGTGAACAATCATGATGTCGG -3'
(R):5'- TCTCTTGATCCGAGCGACAG -3'
Posted On2018-09-12