Mutagenetix > Incidental Mutation

Incidental Mutation 'R6804:Prpf8'

533496

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

044917-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R6804 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75377642-75400275 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75390635 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1262 (K1262R)

Ref Sequence

ENSEMBL: ENSMUSP00000099568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: K1262R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: K1262R

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: K1262R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: K1262R

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131283

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	A	T	1: 58,343,757 (GRCm39)	Q480L	probably benign	Het
Arid4b	T	A	13: 14,303,792 (GRCm39)	D72E	probably benign	Het
Avil	C	T	10: 126,844,175 (GRCm39)	Q245*	probably null	Het
BC048679	T	C	7: 81,146,612 (GRCm39)	S2G	possibly damaging	Het
C1ra	G	A	6: 124,494,684 (GRCm39)	E316K	probably benign	Het
Cacna1d	T	C	14: 29,773,622 (GRCm39)	T1723A	probably benign	Het
Cfap91	T	C	16: 38,152,604 (GRCm39)	D202G	probably damaging	Het
Chil3	A	T	3: 106,071,495 (GRCm39)	Y56*	probably null	Het
Clec2i	A	G	6: 128,872,384 (GRCm39)	E172G	probably damaging	Het
Crybg1	C	T	10: 43,842,337 (GRCm39)	D1785N	probably damaging	Het
Csmd1	G	A	8: 16,087,260 (GRCm39)	R1930W	probably damaging	Het
D430041D05Rik	A	C	2: 103,979,371 (GRCm39)	S2019A	possibly damaging	Het
Ep300	T	A	15: 81,525,512 (GRCm39)	Y1445*	probably null	Het
Gne	A	G	4: 44,060,210 (GRCm39)	I61T	probably damaging	Het
Ifit3b	A	T	19: 34,588,947 (GRCm39)	Q41L	possibly damaging	Het
Kplce	T	C	3: 92,776,354 (GRCm39)	T110A	possibly damaging	Het
Llgl2	A	G	11: 115,734,141 (GRCm39)		probably null	Het
Mast3	T	C	8: 71,239,376 (GRCm39)	I417V	probably benign	Het
Mettl21e	T	A	1: 44,257,295 (GRCm39)	I8F	probably benign	Het
Ms4a2	A	G	19: 11,594,899 (GRCm39)	Y183H	probably damaging	Het
Naip6	C	G	13: 100,435,675 (GRCm39)	E949D	probably benign	Het
Nbea	T	C	3: 55,994,874 (GRCm39)	T181A	probably benign	Het
Nrg1	T	C	8: 32,311,292 (GRCm39)	R476G	probably damaging	Het
Olfm3	A	T	3: 114,916,328 (GRCm39)	Y400F	probably benign	Het
Or12d2	A	G	17: 37,625,021 (GRCm39)	S85P	probably damaging	Het
Or1e33	A	G	11: 73,738,240 (GRCm39)	V237A	probably benign	Het
Or2a25	A	T	6: 42,888,852 (GRCm39)	T132S	probably benign	Het
Or2y1e	A	G	11: 49,218,808 (GRCm39)	D190G	probably benign	Het
Pappa2	T	C	1: 158,764,438 (GRCm39)	S358G	probably benign	Het
Pde4dip	C	A	3: 97,700,564 (GRCm39)	E259*	probably null	Het
Phlpp2	T	A	8: 110,655,197 (GRCm39)	L664Q	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,229,111 (GRCm39)		probably benign	Het
Saal1	GGCTTGCACGCCGT	G	7: 46,349,064 (GRCm39)		probably null	Het
Sec31a	C	T	5: 100,530,671 (GRCm39)	V701I	probably benign	Het
Smarca2	A	T	19: 26,729,286 (GRCm39)	R12S	possibly damaging	Het
Spocd1	T	A	4: 129,847,423 (GRCm39)	C537*	probably null	Het
Syt14	T	C	1: 192,584,161 (GRCm39)	E701G	probably damaging	Het
Taf3	T	C	2: 9,923,028 (GRCm39)	Y32C	possibly damaging	Het
Tfeb	T	C	17: 48,100,735 (GRCm39)		probably null	Het
Ttc13	C	A	8: 125,426,426 (GRCm39)	R168L	probably damaging	Het
Vmn2r11	T	A	5: 109,201,350 (GRCm39)	N385Y	probably damaging	Het
Vmn2r54	T	C	7: 12,363,792 (GRCm39)	K367R	probably benign	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75,386,472 (GRCm39)	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75,381,232 (GRCm39)	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75,386,570 (GRCm39)	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75,390,818 (GRCm39)	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75,392,660 (GRCm39)	nonsense	probably null
IGL02077:Prpf8	APN	11	75,386,635 (GRCm39)	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75,381,498 (GRCm39)	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75,400,084 (GRCm39)	missense	probably benign	0.32
cutter	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
BB009:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75,387,181 (GRCm39)	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75,397,188 (GRCm39)	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75,396,075 (GRCm39)	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75,392,768 (GRCm39)	splice site	probably benign
R0573:Prpf8	UTSW	11	75,381,480 (GRCm39)	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75,394,270 (GRCm39)	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75,384,775 (GRCm39)	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75,385,256 (GRCm39)	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75,399,500 (GRCm39)	unclassified	probably benign
R1123:Prpf8	UTSW	11	75,386,111 (GRCm39)	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75,386,249 (GRCm39)	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75,395,570 (GRCm39)	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75,387,337 (GRCm39)	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75,378,547 (GRCm39)	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75,381,357 (GRCm39)	missense	probably benign
R2185:Prpf8	UTSW	11	75,377,939 (GRCm39)	nonsense	probably null
R2271:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75,386,860 (GRCm39)	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75,397,547 (GRCm39)	splice site	probably null
R3893:Prpf8	UTSW	11	75,391,083 (GRCm39)	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75,381,528 (GRCm39)	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75,383,331 (GRCm39)	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75,400,054 (GRCm39)	splice site	probably null
R5186:Prpf8	UTSW	11	75,380,609 (GRCm39)	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75,391,030 (GRCm39)	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75,397,236 (GRCm39)	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75,399,784 (GRCm39)	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75,394,469 (GRCm39)	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75,394,464 (GRCm39)	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75,395,927 (GRCm39)	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75,395,564 (GRCm39)	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75,391,734 (GRCm39)	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75,400,015 (GRCm39)	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75,384,848 (GRCm39)	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75,384,334 (GRCm39)	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75,382,321 (GRCm39)	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
R6922:Prpf8	UTSW	11	75,381,562 (GRCm39)	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75,395,654 (GRCm39)	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75,386,984 (GRCm39)	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75,399,374 (GRCm39)	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75,381,226 (GRCm39)	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75,394,181 (GRCm39)	nonsense	probably null
R7182:Prpf8	UTSW	11	75,381,553 (GRCm39)	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75,384,783 (GRCm39)	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75,382,610 (GRCm39)	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75,399,738 (GRCm39)	nonsense	probably null
R7522:Prpf8	UTSW	11	75,400,102 (GRCm39)	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75,399,200 (GRCm39)	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75,382,330 (GRCm39)	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75,391,022 (GRCm39)	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75,399,732 (GRCm39)	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75,385,300 (GRCm39)	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75,393,368 (GRCm39)	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75,390,976 (GRCm39)	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75,390,641 (GRCm39)	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75,382,600 (GRCm39)	nonsense	probably null
R8823:Prpf8	UTSW	11	75,384,282 (GRCm39)	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75,386,870 (GRCm39)	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75,380,589 (GRCm39)	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75,387,340 (GRCm39)	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75,397,212 (GRCm39)	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75,394,486 (GRCm39)	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75,385,608 (GRCm39)	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75,385,681 (GRCm39)	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75,394,257 (GRCm39)	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75,397,590 (GRCm39)	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75,394,160 (GRCm39)	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TGCATCATATACGGCCACAC -3'
(R):5'- TAAGCACATGGCCCATCGAG -3'

Sequencing Primer
(F):5'- AAATCTCCAGTAAAGCTCCTTTTC -3'
(R):5'- CCAGCTCCTTAGGGGTGTAGAATAC -3'

Posted On

2018-09-12