Incidental Mutation 'R6804:Llgl2'
ID533497
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R6804 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 115843315 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000172552] [ENSMUST00000173289] [ENSMUST00000177736]
Predicted Effect probably null
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000137900
SMART Domains Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 3e-20 BLAST
SCOP:d1gxra_ 19 158 7e-9 SMART
Blast:WD40 62 101 6e-22 BLAST
Blast:WD40 112 157 2e-22 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155878
SMART Domains Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 1e-20 BLAST
SCOP:d1gxra_ 19 118 3e-8 SMART
Blast:WD40 62 101 3e-22 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172552
SMART Domains Protein: ENSMUSP00000133803
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 4e-21 BLAST
SCOP:d1gxra_ 19 101 1e-7 SMART
Blast:WD40 62 101 2e-22 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000173289
SMART Domains Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 148 4e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,869,047 T110A possibly damaging Het
Aox2 A T 1: 58,304,598 Q480L probably benign Het
Arid4b T A 13: 14,129,207 D72E probably benign Het
Avil C T 10: 127,008,306 Q245* probably null Het
BC048679 T C 7: 81,496,864 S2G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1d T C 14: 30,051,665 T1723A probably benign Het
Chil3 A T 3: 106,164,179 Y56* probably null Het
Clec2i A G 6: 128,895,421 E172G probably damaging Het
Crybg1 C T 10: 43,966,341 D1785N probably damaging Het
Csmd1 G A 8: 16,037,246 R1930W probably damaging Het
D430041D05Rik A C 2: 104,149,026 S2019A possibly damaging Het
Ep300 T A 15: 81,641,311 Y1445* probably null Het
Gne A G 4: 44,060,210 I61T probably damaging Het
Ifit3b A T 19: 34,611,547 Q41L possibly damaging Het
Maats1 T C 16: 38,332,242 D202G probably damaging Het
Mast3 T C 8: 70,786,732 I417V probably benign Het
Mettl21e T A 1: 44,218,135 I8F probably benign Het
Ms4a2 A G 19: 11,617,535 Y183H probably damaging Het
Naip6 C G 13: 100,299,167 E949D probably benign Het
Nbea T C 3: 56,087,453 T181A probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfm3 A T 3: 115,122,679 Y400F probably benign Het
Olfr102 A G 17: 37,314,130 S85P probably damaging Het
Olfr1391 A G 11: 49,327,981 D190G probably benign Het
Olfr393 A G 11: 73,847,414 V237A probably benign Het
Olfr447 A T 6: 42,911,918 T132S probably benign Het
Pappa2 T C 1: 158,936,868 S358G probably benign Het
Pde4dip C A 3: 97,793,248 E259* probably null Het
Phlpp2 T A 8: 109,928,565 L664Q probably damaging Het
Prpf8 A G 11: 75,499,809 K1262R possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 GGCTTGCACGCCGT G 7: 46,699,640 probably null Het
Sec31a C T 5: 100,382,812 V701I probably benign Het
Smarca2 A T 19: 26,751,886 R12S possibly damaging Het
Spocd1 T A 4: 129,953,630 C537* probably null Het
Syt14 T C 1: 192,901,853 E701G probably damaging Het
Taf3 T C 2: 9,918,217 Y32C possibly damaging Het
Tfeb T C 17: 47,789,810 probably null Het
Ttc13 C A 8: 124,699,687 R168L probably damaging Het
Vmn2r11 T A 5: 109,053,484 N385Y probably damaging Het
Vmn2r54 T C 7: 12,629,865 K367R probably benign Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0345:Llgl2 UTSW 11 115849992 splice site probably benign
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1387:Llgl2 UTSW 11 115853132 missense probably damaging 0.99
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R4907:Llgl2 UTSW 11 115853974 nonsense probably null
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGACTACAGACATAAATGAGTCC -3'
(R):5'- GCGGTGCTAAATTCTCACCC -3'

Sequencing Primer
(F):5'- GAGTCCTGTTTTAACTCCAAGCTGAG -3'
(R):5'- AGGGTAAGACTGGCTCTCTC -3'
Posted On2018-09-12