Incidental Mutation 'R6805:Kit'
ID533525
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R6805 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75652808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 881 (I881N)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably damaging
Transcript: ENSMUST00000005815
AA Change: I885N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: I885N

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144270
AA Change: I881N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: I881N

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S126P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCTGCGTGTACACATTTG -3'
(R):5'- CACAGCCATGACATTTGAGCG -3'

Sequencing Primer
(F):5'- CACATTTGAAAGTGATGTCTGGTCC -3'
(R):5'- CATGACATTTGAGCGCGGGTG -3'
Posted On2018-09-12