Incidental Mutation 'R6808:Dlec1'
ID533660
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6808 (G1)
Quality Score208.009
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119126174 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 642 (H642R)
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect probably benign
Transcript: ENSMUST00000055775
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140326
AA Change: H642R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: H642R

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165231
AA Change: H642R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: H642R

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A T 17: 33,433,124 I53F probably damaging Het
Apol7b T A 15: 77,424,673 D75V probably damaging Het
Brd8 C T 18: 34,608,475 A387T probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cacybp T C 1: 160,208,599 probably null Het
Calcoco1 T C 15: 102,710,440 K444E probably damaging Het
Cers2 G A 3: 95,321,009 R120H probably benign Het
Chd4 T A 6: 125,122,123 C1587S possibly damaging Het
Col11a1 A T 3: 114,094,944 K286N possibly damaging Het
Creld2 A G 15: 88,825,210 N308S probably damaging Het
Cyp2d12 T C 15: 82,556,733 S151P probably damaging Het
Eif6 T C 2: 155,823,286 Y151C probably damaging Het
Erbb4 A T 1: 68,040,303 M1206K probably benign Het
Fam178b G A 1: 36,600,135 T361M probably damaging Het
Fbxo10 A G 4: 45,059,035 F234S probably benign Het
Gcc2 A T 10: 58,258,242 E13D probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gtf3c5 T C 2: 28,570,487 K367E probably damaging Het
Ifi204 T C 1: 173,761,703 E54G probably benign Het
Kalrn A T 16: 34,027,976 I492N probably damaging Het
Kif1bp T C 10: 62,575,144 N140S possibly damaging Het
Map2k5 A G 9: 63,322,246 Y168H probably benign Het
Mbip A C 12: 56,337,598 probably null Het
Mcmdc2 C T 1: 9,934,017 T574I probably damaging Het
Olfr1412 A T 1: 92,589,046 R239W probably damaging Het
Olfr153 A T 2: 87,532,941 M303L probably benign Het
Olfr516 T C 7: 108,845,540 T157A probably benign Het
Olfr592 T G 7: 103,187,304 D234E probably benign Het
Olfr924 T A 9: 38,848,789 I225N probably damaging Het
Olfr952 T C 9: 39,426,540 Y177C probably damaging Het
Pdzd8 A G 19: 59,299,525 *1148Q probably null Het
Phactr1 T A 13: 43,132,969 I582N probably damaging Het
Phf20l1 T G 15: 66,630,913 L714R probably damaging Het
Rcor3 T C 1: 192,137,882 E6G possibly damaging Het
Sptlc2 G A 12: 87,350,295 T239I possibly damaging Het
Tmc1 A T 19: 20,795,516 V707D probably damaging Het
Tmem63b T A 17: 45,660,808 E827V probably benign Het
Triml1 A G 8: 43,141,221 S58P probably damaging Het
Ttc37 T C 13: 76,185,179 S1516P probably damaging Het
Zdbf2 A G 1: 63,308,528 H2022R possibly damaging Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 intron probably null
Predicted Primers PCR Primer
(F):5'- TGTGGGAAAAGCTTGAAGCC -3'
(R):5'- GGCACAGCTGTAGTTTCAGG -3'

Sequencing Primer
(F):5'- AAAGCTTGAAGCCTGATCTGGTC -3'
(R):5'- CCTGTCACTGGCTAAGGAATGAC -3'
Posted On2018-09-12