Incidental Mutation 'R6808:Gcc2'
ID533661
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6808 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58258242 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 13 (E13D)
Ref Sequence ENSEMBL: ENSMUSP00000124411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160427] [ENSMUST00000162041] [ENSMUST00000162860] [ENSMUST00000162984]
Predicted Effect probably damaging
Transcript: ENSMUST00000057659
AA Change: E49D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: E49D

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160427
AA Change: E13D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124411
Gene: ENSMUSG00000038039
AA Change: E13D

DomainStartEndE-ValueType
coiled coil region 32 94 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162041
AA Change: E13D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: E13D

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162860
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162984
AA Change: I47F
SMART Domains Protein: ENSMUSP00000124988
Gene: ENSMUSG00000038039
AA Change: I47F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A T 17: 33,433,124 I53F probably damaging Het
Apol7b T A 15: 77,424,673 D75V probably damaging Het
Brd8 C T 18: 34,608,475 A387T probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Cacybp T C 1: 160,208,599 probably null Het
Calcoco1 T C 15: 102,710,440 K444E probably damaging Het
Cers2 G A 3: 95,321,009 R120H probably benign Het
Chd4 T A 6: 125,122,123 C1587S possibly damaging Het
Col11a1 A T 3: 114,094,944 K286N possibly damaging Het
Creld2 A G 15: 88,825,210 N308S probably damaging Het
Cyp2d12 T C 15: 82,556,733 S151P probably damaging Het
Dlec1 A G 9: 119,126,174 H642R probably benign Het
Eif6 T C 2: 155,823,286 Y151C probably damaging Het
Erbb4 A T 1: 68,040,303 M1206K probably benign Het
Fam178b G A 1: 36,600,135 T361M probably damaging Het
Fbxo10 A G 4: 45,059,035 F234S probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gtf3c5 T C 2: 28,570,487 K367E probably damaging Het
Ifi204 T C 1: 173,761,703 E54G probably benign Het
Kalrn A T 16: 34,027,976 I492N probably damaging Het
Kif1bp T C 10: 62,575,144 N140S possibly damaging Het
Map2k5 A G 9: 63,322,246 Y168H probably benign Het
Mbip A C 12: 56,337,598 probably null Het
Mcmdc2 C T 1: 9,934,017 T574I probably damaging Het
Olfr1412 A T 1: 92,589,046 R239W probably damaging Het
Olfr153 A T 2: 87,532,941 M303L probably benign Het
Olfr516 T C 7: 108,845,540 T157A probably benign Het
Olfr592 T G 7: 103,187,304 D234E probably benign Het
Olfr924 T A 9: 38,848,789 I225N probably damaging Het
Olfr952 T C 9: 39,426,540 Y177C probably damaging Het
Pdzd8 A G 19: 59,299,525 *1148Q probably null Het
Phactr1 T A 13: 43,132,969 I582N probably damaging Het
Phf20l1 T G 15: 66,630,913 L714R probably damaging Het
Rcor3 T C 1: 192,137,882 E6G possibly damaging Het
Sptlc2 G A 12: 87,350,295 T239I possibly damaging Het
Tmc1 A T 19: 20,795,516 V707D probably damaging Het
Tmem63b T A 17: 45,660,808 E827V probably benign Het
Triml1 A G 8: 43,141,221 S58P probably damaging Het
Ttc37 T C 13: 76,185,179 S1516P probably damaging Het
Zdbf2 A G 1: 63,308,528 H2022R possibly damaging Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 unclassified probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGTGCACTAAAGCAGGGG -3'
(R):5'- GCTAAACCAAGGCCAGTGATG -3'

Sequencing Primer
(F):5'- AAGGTAGGCCGCTCTTCCAAAG -3'
(R):5'- CCAAGGCCAGTGATGAGGAGATC -3'
Posted On2018-09-12