Incidental Mutation 'R6809:Tenm4'
ID533705
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Nameteneurin transmembrane protein 4
SynonymsDoc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6809 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location96171246-96911093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96553496 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 106 (R106H)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166] [ENSMUST00000129737] [ENSMUST00000138760]
Predicted Effect probably benign
Transcript: ENSMUST00000107162
AA Change: R81H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: R81H

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107165
AA Change: R106H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: R106H

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107166
AA Change: R106H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: R106H

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129737
SMART Domains Protein: ENSMUSP00000120529
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 60 125 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138760
SMART Domains Protein: ENSMUSP00000114281
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 35 100 6.5e-34 PFAM
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,874,282 N61S probably damaging Het
A130010J15Rik T A 1: 193,174,781 V147E possibly damaging Het
Adgrv1 A T 13: 81,472,953 M3893K probably benign Het
Aox3 T C 1: 58,118,681 S66P probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Bloc1s5 A G 13: 38,603,985 V141A probably benign Het
Btbd11 A G 10: 85,631,376 T732A probably benign Het
Col28a1 T C 6: 7,999,468 Y1083C probably damaging Het
Crb1 A G 1: 139,243,126 V842A probably benign Het
Dapk1 A G 13: 60,751,289 S858G probably benign Het
Dlgap2 G T 8: 14,179,619 probably benign Het
Dpysl4 A G 7: 139,093,660 D199G probably benign Het
Eml6 C T 11: 29,803,161 V917I probably benign Het
Fut9 T A 4: 25,620,647 T56S probably benign Het
Gm6205 C A 5: 94,683,418 Q95K probably benign Het
Gtdc1 G C 2: 44,575,551 S214* probably null Het
Gtdc1 A G 2: 44,825,384 F49S probably damaging Het
Hoxd9 A G 2: 74,699,246 Y282C probably damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Krt36 A T 11: 100,105,509 S30T probably benign Het
Lrp1 A G 10: 127,555,056 F2991L probably benign Het
Lrrc34 T A 3: 30,634,600 Q184L possibly damaging Het
Mapk1 A T 16: 17,035,462 M49L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl48 A G 7: 100,546,367 probably benign Het
Ncln A G 10: 81,487,678 probably null Het
Nol4 T A 18: 22,920,825 Q96L probably damaging Het
Olfr1002 G A 2: 85,647,973 A116V probably damaging Het
Olfr1391 G T 11: 49,327,860 V150L probably benign Het
Padi2 A G 4: 140,946,766 probably null Het
Pak7 T G 2: 136,097,581 I545L possibly damaging Het
Paqr5 T A 9: 61,968,782 R157W probably null Het
Pard3b G A 1: 62,161,181 R293H probably damaging Het
Phf11d C A 14: 59,356,395 C110F probably damaging Het
Pkn2 G A 3: 142,799,004 P804S probably damaging Het
Pnpla6 G A 8: 3,534,611 C743Y possibly damaging Het
Pramef17 A G 4: 143,993,081 V238A probably benign Het
Psip1 A G 4: 83,468,642 M164T probably benign Het
Rgs22 C G 15: 36,048,764 S914T probably damaging Het
Rufy4 G A 1: 74,133,047 V310I probably benign Het
Ryr2 G A 13: 11,726,930 L2122F probably damaging Het
Sgcb T G 5: 73,640,693 N142T probably benign Het
Slc27a6 A G 18: 58,605,054 E394G probably benign Het
Slc29a2 T C 19: 5,029,243 V298A probably damaging Het
Slf2 C A 19: 44,943,468 T654N probably damaging Het
Spata4 A C 8: 54,602,333 K123Q possibly damaging Het
Taar7b T C 10: 24,000,858 V307A probably benign Het
Ttn T C 2: 76,863,639 E295G possibly damaging Het
Ubqln4 A T 3: 88,555,372 Q48L possibly damaging Het
Ugt1a10 T A 1: 88,055,925 D148E probably damaging Het
Vmn2r85 T A 10: 130,425,926 N181Y probably benign Het
Wdfy3 C T 5: 101,923,947 V1026I possibly damaging Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 synonymous probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATGCATGGCACTTGGC -3'
(R):5'- TAACCCCGTGTAACCAACGG -3'

Sequencing Primer
(F):5'- CATGCATGGCACTTGGCTAGAG -3'
(R):5'- GAGCCACTCACCGGTTTCTG -3'
Posted On2018-09-12