Incidental Mutation 'R6810:Eif5b'
ID533733
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Nameeukaryotic translation initiation factor 5B
SynonymsA030003E17Rik, IF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37998010-38055579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38046660 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 929 (I929V)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252]
Predicted Effect probably benign
Transcript: ENSMUST00000027252
AA Change: I929V

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: I929V

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38041719 missense probably damaging 1.00
IGL01377:Eif5b APN 1 38036098 missense probably benign
IGL01395:Eif5b APN 1 38037258 missense probably damaging 0.96
IGL01572:Eif5b APN 1 38022254 nonsense probably null
IGL01615:Eif5b APN 1 38045706 missense probably damaging 1.00
IGL02141:Eif5b APN 1 38032322 missense probably benign 0.09
IGL02260:Eif5b APN 1 38045456 missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38041747 missense probably damaging 1.00
IGL03180:Eif5b APN 1 38036269 missense probably damaging 1.00
IGL03327:Eif5b APN 1 38041691 splice site probably benign
R0018:Eif5b UTSW 1 38018889 missense unknown
R0036:Eif5b UTSW 1 38019111 missense probably benign 0.23
R0137:Eif5b UTSW 1 38019243 missense probably benign 0.23
R0349:Eif5b UTSW 1 38032366 missense probably benign 0.18
R0606:Eif5b UTSW 1 38048893 missense probably damaging 1.00
R1056:Eif5b UTSW 1 38022167 missense unknown
R1225:Eif5b UTSW 1 38037628 missense probably damaging 1.00
R2043:Eif5b UTSW 1 38041819 missense probably damaging 1.00
R2163:Eif5b UTSW 1 38048794 missense probably benign 0.32
R2225:Eif5b UTSW 1 38019223 missense unknown
R2432:Eif5b UTSW 1 38019342 missense unknown
R2922:Eif5b UTSW 1 38018019 splice site probably benign
R4357:Eif5b UTSW 1 38050258 missense probably damaging 1.00
R4631:Eif5b UTSW 1 38041747 missense probably damaging 1.00
R4665:Eif5b UTSW 1 38045712 missense probably damaging 1.00
R4702:Eif5b UTSW 1 38018877 missense unknown
R4941:Eif5b UTSW 1 38051199 missense probably damaging 1.00
R4995:Eif5b UTSW 1 38051711 makesense probably null
R5020:Eif5b UTSW 1 38019069 nonsense probably null
R5175:Eif5b UTSW 1 38045387 missense probably damaging 1.00
R5375:Eif5b UTSW 1 38045754 missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38045684 missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38051247 missense probably damaging 1.00
R5853:Eif5b UTSW 1 38037307 missense probably damaging 1.00
R5978:Eif5b UTSW 1 37998280 unclassified probably null
R6315:Eif5b UTSW 1 38018033 missense unknown
R6376:Eif5b UTSW 1 38045679 missense probably damaging 0.98
R6388:Eif5b UTSW 1 38019000 missense unknown
R6444:Eif5b UTSW 1 38036211 missense probably damaging 1.00
R6455:Eif5b UTSW 1 38019027 missense probably benign 0.23
R6877:Eif5b UTSW 1 38050239 missense probably damaging 1.00
R7130:Eif5b UTSW 1 38041776 missense probably damaging 1.00
R7180:Eif5b UTSW 1 38049074 missense probably damaging 0.98
R7439:Eif5b UTSW 1 38051637 missense probably benign 0.28
R7488:Eif5b UTSW 1 38050306 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGCATAGCTGGCTACAGTTG -3'
(R):5'- GTATGGCTAATGCACAAAGATGATG -3'

Sequencing Primer
(F):5'- ATAGCTGGCTACAGTTGGCTCAC -3'
(R):5'- ATGAATTGAAGGTTAGTCTGGGCCC -3'
Posted On2018-09-12