Mutagenetix > Incidental Mutation

Incidental Mutation 'V7732:Rps24'

53377

Institutional Source

Beutler Lab

Gene Symbol

Rps24

Ensembl Gene

ENSMUSG00000025290

Gene Name

ribosomal protein S24

Synonyms

MRP S24

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

V7732 () of strain may

Quality Score

Status

Validated (trace)

Chromosome

Chromosomal Location

24540746-24547028 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24541830 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 6 (T6A)

Ref Sequence

ENSEMBL: ENSMUSP00000152944 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000225023] [ENSMUST00000224568]

AlphaFold

P62849

Predicted Effect

probably benign
Transcript: ENSMUST00000026322

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112384
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: T6A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	23	108	4.4e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169826
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: T6A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	24	102	1.9e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223939

Predicted Effect

probably damaging
Transcript: ENSMUST00000223999
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225023
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224699

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225117

Predicted Effect

probably benign
Transcript: ENSMUST00000224568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224549

Meta Mutation Damage Score

0.2687

Coding Region Coverage

1x: 98.2%
3x: 97.1%
10x: 94.9%
20x: 90.3%

Validation Efficiency

96% (25/26)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy5	T	C	16: 35,103,911 (GRCm39)	F793L	probably benign	Het
Atmin	C	T	8: 117,683,218 (GRCm39)	P293S	probably damaging	Het
Card11	G	A	5: 140,862,250 (GRCm39)	R1016*	probably null	Het
Cep89	A	G	7: 35,102,523 (GRCm39)	S79G	probably damaging	Het
Cic	T	C	7: 24,991,670 (GRCm39)	V2227A	probably benign	Het
Clcn6	A	G	4: 148,098,412 (GRCm39)	V534A	probably damaging	Het
Dpep2	T	A	8: 106,715,892 (GRCm39)	H124L	probably damaging	Het
Elfn1	G	A	5: 139,957,194 (GRCm39)	R66Q	probably damaging	Het
Fanca	G	A	8: 124,031,020 (GRCm39)		probably benign	Het
Ggh	T	A	4: 20,046,225 (GRCm39)	F44L	probably benign	Het
Gpr37	T	C	6: 25,669,122 (GRCm39)	Y574C	probably benign	Het
Heatr5a	C	A	12: 51,952,107 (GRCm39)	A1178S	possibly damaging	Het
Igsf9	A	G	1: 172,317,960 (GRCm39)	T106A	probably benign	Het
Itpr3	G	C	17: 27,330,000 (GRCm39)		probably null	Het
Itpr3	G	T	17: 27,329,998 (GRCm39)		probably benign	Het
Nlrp6	G	A	7: 140,506,561 (GRCm39)		probably benign	Het
Rabac1	T	A	7: 24,671,644 (GRCm39)	Q51L	probably damaging	Het
Rgma	A	G	7: 73,067,068 (GRCm39)	T108A	probably damaging	Het
Sarm1	T	A	11: 78,378,891 (GRCm39)	T385S	probably benign	Het
Spata17	T	C	1: 186,780,677 (GRCm39)	T357A	possibly damaging	Het
Ufl1	T	C	4: 25,251,368 (GRCm39)	I711V	probably damaging	Het
Vwa3a	A	G	7: 120,378,172 (GRCm39)		probably benign	Het

Other mutations in Rps24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02049:Rps24	APN	14	24,541,823 (GRCm39)	missense	probably benign
R1209:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1317:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1363:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1365:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1393:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1427:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1429:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1771:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1776:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R2916:Rps24	UTSW	14	24,542,009 (GRCm39)	missense	probably benign	0.02
R4837:Rps24	UTSW	14	24,541,855 (GRCm39)	missense	possibly damaging	0.93
R6146:Rps24	UTSW	14	24,540,803 (GRCm39)	start gained	probably null
R6249:Rps24	UTSW	14	24,543,530 (GRCm39)	missense	possibly damaging	0.92
R6386:Rps24	UTSW	14	24,542,116 (GRCm39)	missense	possibly damaging	0.79
R7316:Rps24	UTSW	14	24,540,757 (GRCm39)	unclassified	probably benign
R8402:Rps24	UTSW	14	24,540,829 (GRCm39)	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCTCGCTGAATGCCAGCTAC -3'
(R):5'- CCCAGGATGAAGGACATCAATGACC -3'

Sequencing Primer
(F):5'- TCTCCAAGCACTAGAGGCATTG -3'
(R):5'- TGACCTATAAAGAGGTGTAAGAGTC -3'

Posted On

2013-06-26