Incidental Mutation 'R6811:Csf1r'
ID533826
Institutional Source Beutler Lab
Gene Symbol Csf1r
Ensembl Gene ENSMUSG00000024621
Gene Namecolony stimulating factor 1 receptor
SynonymsFms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R6811 (G1)
Quality Score188.009
Status Not validated
Chromosome18
Chromosomal Location61105572-61132149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61119053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 536 (Y536H)
Ref Sequence ENSEMBL: ENSMUSP00000110923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]
PDB Structure
Structure of M-CSF bound to the first three domains of FMS [X-RAY DIFFRACTION]
Structure of mouse Interleukin-34 in complex with mouse FMS [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025523
AA Change: Y536H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: Y536H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115268
AA Change: Y536H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: Y536H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Atrnl1 T G 19: 57,654,961 M427R probably damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm19965 G T 1: 116,804,079 L38F probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Ncf2 G A 1: 152,836,040 V502I probably benign Het
Npsr1 T A 9: 24,134,809 C75S probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Pdx1 T C 5: 147,274,664 S232P possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Slc17a3 A T 13: 23,855,941 I321F possibly damaging Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Csf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Csf1r APN 18 61114825 missense probably benign 0.08
IGL01603:Csf1r APN 18 61129301 missense probably damaging 1.00
IGL02377:Csf1r APN 18 61124468 splice site probably benign
IGL03000:Csf1r APN 18 61109652 missense probably damaging 0.97
IGL03011:Csf1r APN 18 61110401 missense probably benign 0.00
IGL03132:Csf1r APN 18 61128099 missense probably benign 0.03
IGL03189:Csf1r APN 18 61105986 missense probably benign 0.05
IGL03224:Csf1r APN 18 61112062 missense probably damaging 0.96
IGL03351:Csf1r APN 18 61117108 nonsense probably null
ANU74:Csf1r UTSW 18 61117391 missense probably benign 0.09
R1245:Csf1r UTSW 18 61114812 missense probably benign
R1363:Csf1r UTSW 18 61124845 missense possibly damaging 0.95
R1651:Csf1r UTSW 18 61110401 missense possibly damaging 0.64
R1785:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1786:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1902:Csf1r UTSW 18 61130141 missense probably damaging 0.99
R1968:Csf1r UTSW 18 61112795 missense probably benign 0.00
R2177:Csf1r UTSW 18 61114943 splice site probably benign
R3743:Csf1r UTSW 18 61114774 missense probably benign 0.01
R3809:Csf1r UTSW 18 61112764 missense probably benign 0.22
R4374:Csf1r UTSW 18 61119006 missense probably damaging 0.99
R4683:Csf1r UTSW 18 61124911 missense probably damaging 1.00
R4973:Csf1r UTSW 18 61129047 missense probably damaging 1.00
R5080:Csf1r UTSW 18 61124301 missense probably damaging 1.00
R5314:Csf1r UTSW 18 61129724 missense probably damaging 1.00
R5936:Csf1r UTSW 18 61125808 missense probably damaging 1.00
R6015:Csf1r UTSW 18 61109712 missense possibly damaging 0.50
R6227:Csf1r UTSW 18 61125828 nonsense probably null
R6505:Csf1r UTSW 18 61129733 missense probably damaging 1.00
R6602:Csf1r UTSW 18 61110425 missense possibly damaging 0.81
R6813:Csf1r UTSW 18 61112734 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGGGTTTGCATGAAAGCAG -3'
(R):5'- CCCCAACAGGAAAGCTTAGG -3'

Sequencing Primer
(F):5'- AGTGGCTGAGTACTGGCC -3'
(R):5'- AGGGTTATAATGTTAGGAGCTCC -3'
Posted On2018-09-12