Incidental Mutation 'R6812:Lias'
ID533838
Institutional Source Beutler Lab
Gene Symbol Lias
Ensembl Gene ENSMUSG00000029199
Gene Namelipoic acid synthetase
SynonymsmLip1, 4933425M12Rik, MGC7254, 2900022L22Rik, 7a5ex
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65391497-65410693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65408789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 373 (V373E)
Ref Sequence ENSEMBL: ENSMUSP00000113228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031101] [ENSMUST00000031103] [ENSMUST00000122026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031101
AA Change: V289E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031101
Gene: ENSMUSG00000029199
AA Change: V289E

DomainStartEndE-ValueType
Pfam:LIAS_N 4 110 5.8e-49 PFAM
Elp3 126 332 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031103
SMART Domains Protein: ENSMUSP00000031103
Gene: ENSMUSG00000029201

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 195 1.5e-63 PFAM
Pfam:UDPG_MGDP_dh 214 309 1.8e-34 PFAM
UDPG_MGDP_dh_C 332 447 1.89e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122026
AA Change: V373E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113228
Gene: ENSMUSG00000029199
AA Change: V373E

DomainStartEndE-ValueType
Elp3 42 248 1.42e-17 SMART
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biotin and lipoic acid synthetases family. It localizes in mitochondrion and plays an important role in alpha-(+)-lipoic acid synthesis. It may also function in the sulfur insertion chemistry in lipoate biosynthesis. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before weaning. Embryos homozygous for a null allele become growth arrested and die at E7.5-E9.5. Embryos homozygous for an ENU allele survive to E12.5 showing a growth delay, an open neural tube, microcephaly, dilated hearts and lack of dorsal forebrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Lias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Lias APN 5 65405330 missense probably damaging 1.00
IGL02473:Lias APN 5 65405402 missense possibly damaging 0.95
R6812_Lias_838 UTSW 5 65408789 missense possibly damaging 0.76
R1480:Lias UTSW 5 65392291 missense probably benign
R1677:Lias UTSW 5 65391638 missense probably damaging 1.00
R1836:Lias UTSW 5 65392343 missense probably benign
R4077:Lias UTSW 5 65395425 missense probably benign 0.16
R4438:Lias UTSW 5 65395444 missense probably damaging 1.00
R4458:Lias UTSW 5 65394040 splice site probably null
R4710:Lias UTSW 5 65397727 missense probably benign 0.09
R6050:Lias UTSW 5 65393972 missense possibly damaging 0.47
X0061:Lias UTSW 5 65392360 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTTGAAATCTGAGATGAGGG -3'
(R):5'- CACTAAATGTGTGTCGTTTACAGG -3'

Sequencing Primer
(F):5'- TCTGAGATGAGGGAAGTGCCTG -3'
(R):5'- TCGTTTACAGGGTTATAGGCTTC -3'
Posted On2018-09-12