Incidental Mutation 'R6812:Birc3'
ID533850
Institutional Source Beutler Lab
Gene Symbol Birc3
Ensembl Gene ENSMUSG00000032000
Gene Namebaculoviral IAP repeat-containing 3
SynonymsApi2, cIAP2, cIAP-2, HIAP2, IAP2, MIAP2, MIHC, RNF49
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7848699-7873186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 7854417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 424 (D424A)
Ref Sequence ENSEMBL: ENSMUSP00000013949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013949] [ENSMUST00000115672]
Predicted Effect probably damaging
Transcript: ENSMUST00000013949
AA Change: D424A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013949
Gene: ENSMUSG00000032000
AA Change: D424A

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
CARD 438 525 7.29e-4 SMART
RING 555 589 1.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115672
SMART Domains Protein: ENSMUSP00000111336
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125512
Gene: ENSMUSG00000032000
AA Change: D109A

DomainStartEndE-ValueType
SCOP:d1g73d_ 4 35 1e-6 SMART
PDB:3T6P|A 4 106 2e-39 PDB
low complexity region 107 125 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced susceptibility to endotoxic shock. Mice homozygous for a knock-in allele exhibit increased B cell survival and proliferation, lymph node hyperplasia, lymphocytic infiltrates in the lungs, and enlarged gut-associated lympoid tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Birc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Birc3 APN 9 7860732 missense probably damaging 1.00
IGL02852:Birc3 APN 9 7854483 missense probably damaging 0.99
IGL03135:Birc3 APN 9 7849721 splice site probably benign
R0478:Birc3 UTSW 9 7860347 missense probably damaging 1.00
R0905:Birc3 UTSW 9 7851051 makesense probably null
R1934:Birc3 UTSW 9 7854499 missense possibly damaging 0.89
R2005:Birc3 UTSW 9 7860341 missense probably damaging 1.00
R3019:Birc3 UTSW 9 7857389 critical splice donor site probably null
R4169:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R4964:Birc3 UTSW 9 7860552 missense probably benign 0.01
R5338:Birc3 UTSW 9 7857359 missense probably benign 0.01
R5395:Birc3 UTSW 9 7861174 missense probably damaging 1.00
R5877:Birc3 UTSW 9 7849346 missense probably damaging 1.00
R5914:Birc3 UTSW 9 7857342 makesense probably null
R6148:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R6471:Birc3 UTSW 9 7857420 missense probably benign 0.00
R6747:Birc3 UTSW 9 7860261 critical splice donor site probably null
R6752:Birc3 UTSW 9 7857344 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AACATAAGAAAGGCCAGGCT -3'
(R):5'- CCTGGAGAAAGTTCGGAAGATG -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- ATGTCGTCATGATGAGCACGC -3'
Posted On2018-09-12