Incidental Mutation 'R6812:Arid4a'
ID533865
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71047263 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 270 (E270G)
Ref Sequence ENSEMBL: ENSMUSP00000035512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000125125] [ENSMUST00000135709]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046305
AA Change: E270G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: E270G

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125125
AA Change: E270G
SMART Domains Protein: ENSMUSP00000121109
Gene: ENSMUSG00000048118
AA Change: E270G

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 5.53e-10 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 168 263 6e-49 PFAM
low complexity region 267 295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135709
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
after_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
Under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 intron probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
R7387:Arid4a UTSW 12 71087496 missense probably damaging 1.00
R7570:Arid4a UTSW 12 71063142 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTACATGGTCTTCTGACTCATG -3'
(R):5'- GCCCCAGAGCAAAAGCATAG -3'

Sequencing Primer
(F):5'- ACATGGTCTTCTGACTCATGAGACC -3'
(R):5'- CGTTGACCTACCAGCTC -3'
Posted On2018-09-12