Incidental Mutation 'R6812:Kif2a'
ID533869
Institutional Source Beutler Lab
Gene Symbol Kif2a
Ensembl Gene ENSMUSG00000021693
Gene Namekinesin family member 2A
SynonymsKns2, Kif2, M-kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location106958996-107022126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106969751 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 570 (D570E)
Ref Sequence ENSEMBL: ENSMUSP00000125644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022204] [ENSMUST00000117423] [ENSMUST00000117539] [ENSMUST00000122233] [ENSMUST00000159772]
Predicted Effect probably benign
Transcript: ENSMUST00000022204
SMART Domains Protein: ENSMUSP00000022204
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 6.56e-147 SMART
low complexity region 613 625 N/A INTRINSIC
coiled coil region 660 698 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117423
SMART Domains Protein: ENSMUSP00000113921
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 113 137 N/A INTRINSIC
KISc 174 514 6.56e-147 SMART
low complexity region 567 579 N/A INTRINSIC
coiled coil region 614 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117539
SMART Domains Protein: ENSMUSP00000113361
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
KISc 204 544 6.56e-147 SMART
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122233
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112715
Gene: ENSMUSG00000021693
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
KISc 193 533 4.33e-147 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
coiled coil region 671 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159772
AA Change: D570E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125644
Gene: ENSMUSG00000021693
AA Change: D570E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 4.33e-147 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
coiled coil region 698 736 N/A INTRINSIC
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plus end-directed motor required for normal mitotic progression. The encoded protein is required for normal spindle activity during mitosis and is necessary for normal brain development. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality, abnormal lamination of the cerebral cortex, hippocampus and cerebellum, impaired neuronal migration, and abnormal axon outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Kif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Kif2a APN 13 106968793 splice site probably benign
IGL01640:Kif2a APN 13 106974552 missense probably damaging 1.00
IGL02524:Kif2a APN 13 106964355 missense possibly damaging 0.82
R0088:Kif2a UTSW 13 106975432 missense probably damaging 1.00
R0276:Kif2a UTSW 13 106976650 splice site probably benign
R1233:Kif2a UTSW 13 106987332 missense probably damaging 1.00
R1345:Kif2a UTSW 13 106993915 missense probably damaging 0.99
R1772:Kif2a UTSW 13 106978132 intron probably benign
R1900:Kif2a UTSW 13 106976995 missense possibly damaging 0.46
R1932:Kif2a UTSW 13 106978091 missense probably benign 0.00
R2364:Kif2a UTSW 13 106976836 missense probably damaging 1.00
R3177:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R3277:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R4646:Kif2a UTSW 13 106962185 missense probably damaging 1.00
R5566:Kif2a UTSW 13 106993924 unclassified probably null 1.00
R5761:Kif2a UTSW 13 106962164 missense probably benign 0.05
R5797:Kif2a UTSW 13 106975376 missense probably damaging 1.00
R7025:Kif2a UTSW 13 106982594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCTGCTAAATGAAAATGG -3'
(R):5'- AGAAGGGAAAGATTTCGGGTTTTC -3'

Sequencing Primer
(F):5'- CCTGCTAAATGAAAATGGAAAATGGC -3'
(R):5'- AGGTGGGGATTAATAAAACTTAAGTG -3'
Posted On2018-09-12