Incidental Mutation 'R6812:Zfp318'
ID533874
Institutional Source Beutler Lab
Gene Symbol Zfp318
Ensembl Gene ENSMUSG00000015597
Gene Namezinc finger protein 318
Synonyms2610034E08Rik, D530032D06Rik, TZF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6812 (G1)
Quality Score217.468
Status Validated
Chromosome17
Chromosomal Location46383731-46420920 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to GAAGAAT at 46412542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]
Predicted Effect probably benign
Transcript: ENSMUST00000113481
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138127
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152472
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Zfp318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
Wonton UTSW 17 46409692 missense possibly damaging 0.89
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1327:Zfp318 UTSW 17 46413263 missense probably damaging 1.00
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1800:Zfp318 UTSW 17 46412054 missense probably benign 0.00
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 intron probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4564:Zfp318 UTSW 17 46412815 missense possibly damaging 0.77
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5643:Zfp318 UTSW 17 46409244 intron probably benign
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6980:Zfp318 UTSW 17 46397212 missense probably damaging 1.00
R6999:Zfp318 UTSW 17 46400043 missense probably damaging 1.00
R7164:Zfp318 UTSW 17 46397306 critical splice donor site probably null
R7164:Zfp318 UTSW 17 46405939 missense probably damaging 1.00
R7175:Zfp318 UTSW 17 46386848 missense probably damaging 1.00
R7233:Zfp318 UTSW 17 46406052 missense probably damaging 0.99
R7339:Zfp318 UTSW 17 46411247 missense probably damaging 0.99
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTTGACCTGGGAGAGCCAG -3'
(R):5'- TTGGATTCTGGAGCAATGACG -3'

Sequencing Primer
(F):5'- ACTTCTCATCTATCAGATACACACTG -3'
(R):5'- TTCTGGAGCAATGACGGAAATAAATC -3'
Posted On2018-09-12