Incidental Mutation 'R6812:Rbm27'
ID533877
Institutional Source Beutler Lab
Gene Symbol Rbm27
Ensembl Gene ENSMUSG00000024491
Gene NameRNA binding motif protein 27
SynonymsPsc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location42275353-42341542 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 42333403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
Predicted Effect probably null
Transcript: ENSMUST00000046972
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091920
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Meta Mutation Damage Score 0.6364 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rbm27 APN 18 42319814 missense possibly damaging 0.82
IGL01630:Rbm27 APN 18 42301840 missense probably damaging 1.00
IGL02045:Rbm27 APN 18 42319913 missense possibly damaging 0.52
IGL03031:Rbm27 APN 18 42333399 critical splice donor site probably null
IGL03085:Rbm27 APN 18 42327524 splice site probably benign
IGL03249:Rbm27 APN 18 42301747 missense probably damaging 0.99
IGL03372:Rbm27 APN 18 42305716 missense probably damaging 0.99
messenger UTSW 18 42333403 splice site probably null
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0111:Rbm27 UTSW 18 42305672 splice site probably benign
R0122:Rbm27 UTSW 18 42313968 intron probably benign
R0707:Rbm27 UTSW 18 42326026 critical splice donor site probably null
R1253:Rbm27 UTSW 18 42301774 missense probably damaging 0.99
R1268:Rbm27 UTSW 18 42333302 missense probably damaging 1.00
R1317:Rbm27 UTSW 18 42324051 splice site probably benign
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R2187:Rbm27 UTSW 18 42325957 missense probably damaging 1.00
R2358:Rbm27 UTSW 18 42292112 splice site probably benign
R3123:Rbm27 UTSW 18 42327165 missense probably damaging 1.00
R3711:Rbm27 UTSW 18 42292112 splice site probably benign
R3712:Rbm27 UTSW 18 42292112 splice site probably benign
R4616:Rbm27 UTSW 18 42301775 missense probably damaging 0.96
R4839:Rbm27 UTSW 18 42327445 missense probably damaging 1.00
R5151:Rbm27 UTSW 18 42338444 missense probably damaging 1.00
R5308:Rbm27 UTSW 18 42327210 missense probably damaging 1.00
R5696:Rbm27 UTSW 18 42317666 missense probably damaging 1.00
R5868:Rbm27 UTSW 18 42300385 missense possibly damaging 0.86
R6058:Rbm27 UTSW 18 42327505 missense probably damaging 1.00
R6477:Rbm27 UTSW 18 42333318 missense probably damaging 1.00
R6499:Rbm27 UTSW 18 42337011 missense probably damaging 1.00
R6658:Rbm27 UTSW 18 42324113 missense probably damaging 1.00
R6700:Rbm27 UTSW 18 42325939 missense probably damaging 1.00
R6784:Rbm27 UTSW 18 42301864 missense probably benign 0.00
R7162:Rbm27 UTSW 18 42314027 missense unknown
X0065:Rbm27 UTSW 18 42299320 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TATTTTACCTGTGGGGAGAGGAAAG -3'
(R):5'- TTGGAACACCATGCCACTAC -3'

Sequencing Primer
(F):5'- GGAGAGGAAAGACCATATCCTCTC -3'
(R):5'- CCATGCCACTACAAACATGTTTATG -3'
Posted On2018-09-12