Incidental Mutation 'R6812:Phka2'
ID533882
Institutional Source Beutler Lab
Gene Symbol Phka2
Ensembl Gene ENSMUSG00000031295
Gene Namephosphorylase kinase alpha 2
Synonyms6330505C01Rik, Phk, k
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6812 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location160502166-160598878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 160533048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 230 (V230I)
Ref Sequence ENSEMBL: ENSMUSP00000107999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033652] [ENSMUST00000112376] [ENSMUST00000112377] [ENSMUST00000112380]
Predicted Effect probably damaging
Transcript: ENSMUST00000033652
AA Change: V230I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033652
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 9.2e-200 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112376
AA Change: V230I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107995
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 521 1.5e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112377
AA Change: V230I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107996
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 9.2e-200 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112380
AA Change: V230I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107999
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 4.5e-197 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Meta Mutation Damage Score 0.2076 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9A, also known as X-linked liver glycogenosis. Alternatively spliced transcript variants have been reported, but the full-length nature of these variants has not been determined.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Phka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Phka2 APN X 160564213 missense possibly damaging 0.68
IGL02179:Phka2 APN X 160554380 critical splice donor site probably null
IGL03034:Phka2 APN X 160577550 nonsense probably null
R1996:Phka2 UTSW X 160541415 missense probably benign 0.27
R2054:Phka2 UTSW X 160554327 missense probably damaging 1.00
R2237:Phka2 UTSW X 160541412 missense probably damaging 1.00
R2238:Phka2 UTSW X 160541412 missense probably damaging 1.00
R2239:Phka2 UTSW X 160541412 missense probably damaging 1.00
R3622:Phka2 UTSW X 160544295 nonsense probably null
R3623:Phka2 UTSW X 160544295 nonsense probably null
R3701:Phka2 UTSW X 160533049 missense possibly damaging 0.95
R5735:Phka2 UTSW X 160559866 frame shift probably null
R5736:Phka2 UTSW X 160559866 frame shift probably null
R5737:Phka2 UTSW X 160559866 frame shift probably null
R5738:Phka2 UTSW X 160559866 frame shift probably null
R6813:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6957:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6960:Phka2 UTSW X 160533048 missense probably damaging 0.99
X0066:Phka2 UTSW X 160549272 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCATTGCCATTAGGAGAAACATG -3'
(R):5'- TTTGGCTGTTAGCTCCACAC -3'

Sequencing Primer
(F):5'- GCCATTAGGAGAAACATGTATGTTAG -3'
(R):5'- GACGAGTTGCCCAGGTTCATTTAC -3'
Posted On2018-09-12