Incidental Mutation 'R6842:Wdsub1'
ID533887
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6842 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59878188 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 114 (S114A)
Ref Sequence ENSEMBL: ENSMUSP00000114811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751] [ENSMUST00000128671] [ENSMUST00000133809] [ENSMUST00000140475]
Predicted Effect probably benign
Transcript: ENSMUST00000028368
AA Change: S114A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988
AA Change: S114A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102751
AA Change: S114A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988
AA Change: S114A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128671
AA Change: S114A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121242
Gene: ENSMUSG00000026988
AA Change: S114A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
Blast:WD40 169 194 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133809
SMART Domains Protein: ENSMUSP00000114814
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 7 46 1.5e-3 SMART
WD40 48 96 2.48e-4 SMART
WD40 106 145 6e-3 SMART
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139689
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140475
AA Change: S114A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114811
Gene: ENSMUSG00000026988
AA Change: S114A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
Blast:WD40 169 194 1e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,432 N69S probably benign Het
9130011E15Rik A G 19: 45,818,977 V660A probably benign Het
Adgrl3 C T 5: 81,741,080 A1042V probably damaging Het
Armc4 C T 18: 7,268,401 D373N probably benign Het
C1s2 T A 6: 124,627,502 H395L probably benign Het
Cacna1e A G 1: 154,483,117 I307T probably damaging Het
Cap2 T C 13: 46,646,625 S381P probably damaging Het
Cbfa2t2 A G 2: 154,524,045 T392A probably benign Het
Ccdc127 T C 13: 74,356,969 I212T probably damaging Het
Cela3a A G 4: 137,405,668 V91A probably benign Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Csmd2 T C 4: 128,509,159 F2347L possibly damaging Het
Ddx19a A G 8: 110,978,625 V288A possibly damaging Het
Fbxl5 T C 5: 43,773,586 E53G probably damaging Het
Fbxw26 A T 9: 109,724,920 I217N probably damaging Het
Fgfr1op2 T A 6: 146,590,038 probably null Het
Ighv1-37 A T 12: 114,896,655 I6N probably damaging Het
Klhdc10 T C 6: 30,439,782 L128P probably damaging Het
Lypla1 C T 1: 4,832,340 S24F probably benign Het
Mme T A 3: 63,362,044 D591E probably damaging Het
Mmp1b T A 9: 7,384,888 I254F probably damaging Het
Msr1 T C 8: 39,632,825 M5V probably benign Het
Myh8 A G 11: 67,284,655 D312G probably damaging Het
Nav2 T C 7: 49,458,169 Y709H possibly damaging Het
Oas1g T C 5: 120,887,558 E2G probably benign Het
Ocm T A 5: 144,025,691 I6F unknown Het
Olfr160 T C 9: 37,711,589 N230S probably benign Het
Olfr275 T C 4: 52,825,576 Y60H probably damaging Het
Olfr693 T C 7: 106,677,886 Y200C probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pax1 A G 2: 147,373,720 D419G probably benign Het
Plbd1 T A 6: 136,635,614 I194F probably benign Het
Prdx6 A T 1: 161,247,370 C47S probably damaging Het
Sec24d T C 3: 123,343,219 S534P probably benign Het
Sgk3 T C 1: 9,898,754 V452A probably benign Het
Sipa1l1 T C 12: 82,420,546 V1177A probably benign Het
Tgfbr1 T C 4: 47,383,757 C32R probably damaging Het
Trim66 T C 7: 109,460,776 N801S probably benign Het
Utp6 C T 11: 79,940,949 S504N probably benign Het
Wfikkn2 T C 11: 94,238,040 E425G probably damaging Het
Zfp956 C T 6: 47,963,829 T374I possibly damaging Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 unclassified probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R1767:Wdsub1 UTSW 2 59858714 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4987:Wdsub1 UTSW 2 59870393 intron probably benign
R4989:Wdsub1 UTSW 2 59870414 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6582:Wdsub1 UTSW 2 59878308 missense probably damaging 1.00
R6638:Wdsub1 UTSW 2 59870441 intron probably benign
R6678:Wdsub1 UTSW 2 59862631 missense probably benign 0.45
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
R7041:Wdsub1 UTSW 2 59852880 missense probably damaging 1.00
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGTTACGGTTTCTAGAGTAC -3'
(R):5'- TATGCTGTCCACTGCTGCTG -3'

Sequencing Primer
(F):5'- GCTCTACAGAGTGAGTTCCAG -3'
(R):5'- GTTTCTCACCCTCAGGACACG -3'
Posted On2018-09-12