Incidental Mutation 'R6813:Dab2ip'
ID533926
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Namedisabled 2 interacting protein
Synonyms2310011D08Rik, AIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R6813 (G1)
Quality Score204.009
Status Validated
Chromosome2
Chromosomal Location35558266-35730994 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 35730473 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1118 (Q1118*)
Ref Sequence ENSEMBL: ENSMUSP00000122341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000112992] [ENSMUST00000135741] [ENSMUST00000145698]
Predicted Effect probably benign
Transcript: ENSMUST00000065001
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091010
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112983
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112986
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112987
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112992
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124098
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135741
AA Change: Q1118*
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: Q1118*

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156669
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35720013 missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35707775 missense probably benign 0.25
IGL00902:Dab2ip APN 2 35717112 missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35708877 missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35643897 missense probably benign 0.27
R0097:Dab2ip UTSW 2 35718916 missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35692376 critical splice donor site probably null
R0184:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1388:Dab2ip UTSW 2 35721256 intron probably benign
R1442:Dab2ip UTSW 2 35710256 missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1665:Dab2ip UTSW 2 35720278 missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35718815 missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35643891 nonsense probably null
R3819:Dab2ip UTSW 2 35713210 missense probably damaging 1.00
R4333:Dab2ip UTSW 2 35661620 makesense probably null
R4869:Dab2ip UTSW 2 35720037 missense probably damaging 1.00
R4894:Dab2ip UTSW 2 35730527 utr 3 prime probably benign
R5035:Dab2ip UTSW 2 35709941 missense probably benign 0.03
R5180:Dab2ip UTSW 2 35720491 missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35709991 missense probably benign 0.25
R5513:Dab2ip UTSW 2 35710254 missense probably benign 0.11
R5579:Dab2ip UTSW 2 35715327 nonsense probably null
R5829:Dab2ip UTSW 2 35707775 unclassified probably benign
R5840:Dab2ip UTSW 2 35727499 missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35715402 missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35692255 nonsense probably null
R6235:Dab2ip UTSW 2 35723087 missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35710266 missense probably benign 0.38
R6571:Dab2ip UTSW 2 35712890 missense probably damaging 1.00
R7262:Dab2ip UTSW 2 35622286 splice site probably null
X0011:Dab2ip UTSW 2 35723085 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCTTTGCAGTCTAGGTGTC -3'
(R):5'- TCCCAGACCTATGAGTATGAGGG -3'

Sequencing Primer
(F):5'- CAGTCTAGGTGTCTGTCTGTC -3'
(R):5'- TACACGTTGAGCTCTGGC -3'
Posted On2018-09-12