Incidental Mutation 'R6814:Ccdc24'
ID533994
Institutional Source Beutler Lab
Gene Symbol Ccdc24
Ensembl Gene ENSMUSG00000078588
Gene Namecoiled-coil domain containing 24
SynonymsLOC381546
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6814 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117866524-117872557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117869926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 196 (T196A)
Ref Sequence ENSEMBL: ENSMUSP00000132114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000167443] [ENSMUST00000169885] [ENSMUST00000171052]
Predicted Effect probably benign
Transcript: ENSMUST00000030266
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030269
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106421
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
AA Change: T196A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588
AA Change: T196A

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163288
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164853
AA Change: T196A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588
AA Change: T196A

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588
AA Change: T76A

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169885
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171052
AA Change: T224A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588
AA Change: T224A

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abca7 G A 10: 80,002,999 V669I probably damaging Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Afap1l1 A T 18: 61,733,741 V749E probably benign Het
Arfgef3 A G 10: 18,595,019 L1666S probably damaging Het
Atp2b1 A G 10: 99,023,015 N284D possibly damaging Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Cit G A 5: 115,884,963 C283Y probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Cspg4 A G 9: 56,890,340 I1363V possibly damaging Het
D2hgdh C A 1: 93,835,303 T270N possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Fam53a T C 5: 33,610,485 Y27C probably benign Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nr1h4 T C 10: 89,454,745 T474A probably damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Pigq A T 17: 25,931,656 probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Slc17a2 T C 13: 23,822,389 I466T possibly damaging Het
Slc24a3 C T 2: 145,616,710 Q537* probably null Het
Slc7a10 T C 7: 35,195,264 V116A probably damaging Het
Taf15 T A 11: 83,499,089 N228K probably damaging Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp189 A T 4: 49,529,026 N43I probably damaging Het
Zfp36l2 A G 17: 84,186,093 probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Other mutations in Ccdc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Ccdc24 APN 4 117872046 missense probably damaging 1.00
IGL02396:Ccdc24 APN 4 117869629 missense possibly damaging 0.91
IGL03122:Ccdc24 APN 4 117871745 critical splice donor site probably null
R1473:Ccdc24 UTSW 4 117869904 splice site probably benign
R1488:Ccdc24 UTSW 4 117870568 missense possibly damaging 0.88
R1986:Ccdc24 UTSW 4 117872016 missense probably damaging 1.00
R2233:Ccdc24 UTSW 4 117869916 missense possibly damaging 0.53
R4983:Ccdc24 UTSW 4 117872100 missense probably benign 0.06
R5250:Ccdc24 UTSW 4 117869629 missense possibly damaging 0.91
R5677:Ccdc24 UTSW 4 117869880 intron probably benign
R6092:Ccdc24 UTSW 4 117872448 nonsense probably null
R6265:Ccdc24 UTSW 4 117871177 nonsense probably null
R6284:Ccdc24 UTSW 4 117869653 unclassified probably null
R6736:Ccdc24 UTSW 4 117870535 missense possibly damaging 0.81
R6872:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R7016:Ccdc24 UTSW 4 117871116 missense probably null 1.00
R7073:Ccdc24 UTSW 4 117872004 missense probably damaging 1.00
Z1088:Ccdc24 UTSW 4 117871063 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCTGTACCGAAGTTGCCG -3'
(R):5'- AATGCCTACCCTGGGAGGTAAG -3'

Sequencing Primer
(F):5'- TACCGAAGTTGCCGTCCCC -3'
(R):5'- TAAGGTCCCCAGGCGAG -3'
Posted On2018-09-12